GenePrediction:GLEAN_312 Details

Name: GLEAN_312
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:968118..969977 (+ strand)
Length: 1860
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:968118..968135 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_167:968207..969037 (+ strand)
Length: 831
Type: CDS
Source: GLEAN
Position: GCSC_167:969121..969647 (+ strand)
Length: 527
Type: CDS
Source: GLEAN
Position: GCSC_167:969713..969977 (+ strand)
Length: 265
>GLEAN_312 class=GenePrediction position=GCSC_167:968118..969977 (+ strand)
ATGGCGCCGCGACGAATCGTAAGTCAGAATGGTGTTTTCCGATGGCAAGAATCCCAACGACACATGCTGACAGGTAGATG
CATCCCTAGGTTCGCACCGTTTTGCAGGTGGCAATAGCGGGCATCTTCACCTGCATCGTCGTATTCTTCCTCGATCGCAA
CTACCGCGTCTTGCCGAATGCCTTGCATGAATATCTCCCACAGCCCCATAATGGGCTCATCATCACCGACATCCGCATCA
CCAAGTGCTCCTCTCTCAATGTCTTTTCGTCGTGCACGCTGGACTCTGATGTGTGGCATCGCATCGAGAAGGACTTGTAT
CTGGGCAAGAGCCTGTCGCATGCGTATGTGCACATTCAGCGGAAGCGAGAGGAGGAGCTGCAGCCGGAGGACAAGATCGT
CGTCGACGTCACCGTTGGAAGGCTCGACCCCGGGTCCAGCGACAAGGGACAGGAGGAGGAGCACTGGGACTCACGGGGTG
CCGGCCTGTGGGTGAAGCGCACGGCAAAGAGGCGTGTGGCCGACACGAAGAGCGCGGTCACGGCCGTGGATGTGCTGTTC
GGCGAGGATGCCGTGGAGGCGCGTGACGGCTGGGCCATCAAGGGCACGCCGCTGCTCCTGGACGGCAGCATGGTATCCCA
TGTGACCGTGCGCACTGGCAGCCACCACGACGTGAACAAGCCGCAGCTGCGCATCGGCGACAATGGCAAGTTTAAGATCG
TGCAGCTGGCCGACCTGCACCTGAGCACGGGCGTGGGCCATTGCCGCGATGCCGTGCCAGACACGTACAAGGGCGGGAAG
TGCGAGGCAGACCCGCGAACGCTGGACTTTGTGGCCCGCGTCCTGGAGGAGGAGCGGCCAGACCTGGTCGTGCTGAGTGG
CGACCAGGTCAACGGCGAAACGGCTCCGGATGTACAGTCGGTGAGTTGGCCTGCTGGAGGAGGGACTTCTGCGGCGGAAA
CTGCAAAACTAACGATTTGCCGCTTCTATTTCGGGAATCTTAGGCCATCTTCAAATATGCACATCTCCTGATCAAGCACA
ACATCCCCTACGTCTCCATTTTCGGGAACCACGACGACGAGGGCTCGCTGCCGCGATCCAGCCAGATGGCGCTCATCGAG
ACCCTGCCCTTATCGTTGTCGGAGGCGGGCCCGGACAGCATTGCCGGCGTAGGGAACTACGTGGTGGAGGTGCTGGCACG
AGGCGGCTCATCGCACTCGGCACTGACTATCTACCTTCTGGACACGCACGCCTACTCGCCGGATGAGCACAAGTACAAGG
GCTACGACTGGCTCAAACCGGATCAGATCGACTGGTTCCGCCAGACGGCACAGGGACTGAAGAAGAGCCACGCCGAATAC
ACGCACATGCACATGGACGTGGCATTCATCCATATTCCGGTTCCCGAGTACCGCGACCCGAACCTCTACTTCAAGGGCGA
CTGGAAGGAGCCCCCGACGGCGCCGGCGTTCAACTCCAAGTTCCGCGACGCTCTGGTGGAAGAGGGCATTTCTATGGTCA
GCTGTGGACAGTACGTTTCTCTCCCTTACTCCATCTCATCGTGCGTCTCTTCGTTGGCACTAATATGCGGCACAGCGATC
ATGTTAACGAGTACTGCGCCCTATCCGTGGACGAAAGCAACCAGCCGAAGCTCTGGATGTGCTACGGCGGTGGAGCGGGT
TTCGGTGGTTATGGCGGCTACGGCGGCTTCCTCCGCAAAATCCGGGTGTTCGATTTCGACATGAACGAGGGCCGGATTGC
CACCTGGAAGCGGGTAGAGTATGGCGAAAATGTTGGCAAGCAGCTGGACGTCCAGATCATTGTGGATGCGGGCCGGCCTG
TCCTGCCGGCTGAAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62