GenePrediction:GLEAN_3136 Details

Name: GLEAN_3136
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:404454..405619 (+ strand)
Length: 1166
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:404454..404509 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_161:404560..404635 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_161:405116..405619 (+ strand)
Length: 504
>GLEAN_3136 class=GenePrediction position=GCSC_161:404454..405619 (+ strand)
ATGTTGGACTATTCCCTCGTGGCATCCAGCGGCATCAGCCTCGAGAACATCTCAGGGTATGCTACGATTGGGTTAAGAAC
CCCTACAAACTGTTTCGTGCTTACAGCATATACTACCTGCATAAGCTCATCCTCGATGCAAAGAAAATGGACCAGGATGT
TAAGGATGCTGGGCGCGACAGCGTGAGTGCTGCTAAACAGCTACGGCATAGCACCCAATAACTCAGCGGGGTTTTTAGGA
GGTCGCTTGATTTTGCGAGTGATGCGGCATCACGTGGGTTTTCGTTCTCCTCAATGCATTTCGAAATTGAGTAGCTATTG
TGTTTCAAAAACAGCAGTGCCACGCATTTGACTGATCACAAAATGCATGTGCTCGACAGCTATTTTGGCTGTGCTCGTAG
TTGGCTGTGTACACGTGAAATGTTGATTTACGCGAATAACTATGTATTTGAACAGTCTAATTCAATATGCAGGTAAGACC
CAGTATATCTTATGAAGATTCATGCTTATTAATGTGCTACAATACCGAACGGAAATGGCAACTCTTCTTTGAAAACATCA
AAAATAAATCCGTATGATTTGGTAAACTTAATGCACCCTTTGACACGCGACCTACTCGCCATGGCAGAAAAACGCGACAT
CATCCTCTCCATCCACCCTCAGCACGTCGAGAACATTGTTCGCCACAGAAAAAACCACGAGTTTCGCAACTACAAGCTTC
CCACCCAGCGAATGTGGATCTACGAGACGCGTCCAGCATCCGCCATTCGCTTTCGAGCCACCATCAGCCACGGCAAGCGC
CCCGGCGAGATTAAAAACCCCAGCGGCCTGCGCAACGACGAGTTTGACCGCGGCGACCTAGCTGGGCGTGTTCAGTTTGG
CTACGAGATTCTAAAGCTAGAACGCCTCGCACAACCGATTTCGCTGGAGGAGCTAAAGAAGAACGGCTGGCTAAAAGGAC
CACCGCAAAAGTATTGCTTTGTAATGCCGGCATTTGACAAGGTCTTGCAGGCGAGGGAATTGGAGCTGGTCTTTGATGCC
ACGACCGCGAGAGCTTCAGGTACAACCGCTTGCAAGGCTACGCAGGTGAAGGAAACAGTGGGAAAGGACGAAATTGGGAA
CGATGATGGGGCCGGGCAGTCGGGGGGTCCGACAAATTGCTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62