GenePrediction:GLEAN_3137 Details

Name: GLEAN_3137
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:406813..408126 (+ strand)
Length: 1314
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:406813..406974 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_161:407063..407116 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_161:407291..407434 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_161:407491..408126 (+ strand)
Length: 636
>GLEAN_3137 class=GenePrediction position=GCSC_161:406813..408126 (+ strand)
ATGCCGTCAGCAGTTCCGGTACAGTCGTCTCCGCTGCGCAGATGGGTGCGCCCAGACAAGACGAGGCAGGACCTTCCCTG
GGCTGATATTGCAGCTATTGATCTGAGCAAGTTCGACCAGCCCGGCGGCAAGGATCAGCTTGTGGAGGACCTCCGACAAG
CAGTAGGTTTTTGGGAGAGATGCATTCCTCAGCCCTACCCCCTTCCCTTAGTGATCAACTGTTCGATATCTGATGCCTTA
CGGCTGATAGGTACACGAGACGGGATTCTTCGGACTCATCAACACTGGTTTCACGCCAGAGGAAGTGGAGCGCCAATATG
ACATTGGACAGGGCTTCTTTGACCTTTCCGTCGAGGAGAAAGATCAGCCGGGCAACCGGTGTGACTTCTCCAAGGGAAAC
TACTTTGGATACAGAAGAGCAAGTGCTGGACCTTTAAAACGTTGCTGATGCGACTGAACTAACACGATTTATGATCAGAA
CAACGACAAGAAGATGCTGGGACCAGAAGTGAGGAACAACTCCGAATCGGTTAACATCCCCAAGTTTACGGCGTACTACG
CCAACGAGCCGTTCCACTCCTTTTTCGAGCCGTATAGGGACGAAATTGAGAGCTTCTCTCGGGTACGTGAAGGCCGATGT
ATCGACCAAGAAGGTTGCTTACTAAGCATATTGTGCAGCGCTCTCTTGACCTCGCGAGCCGGGTATTTCGCCTCTTTGCA
CTCATCCTGGAGCTGCCGGAGGACTTCTTCTCCTCGCGGCACGAGTACAGTCTGCCGAGCGAGGACCATCTGCGGTACAT
GCGGTACCATCCGCGGACGTTGGCCGACGACGTAAAGGTCGAGCGCAACTGGTCGCGCGCCCACACCGACTTTGGCTCGC
TCACCCTCCTCTGGAGCCAGGATGTGGCCGGGCTGCAGATCAAGACGCGGTCGGGCGAGTGGCGCTACGTACCCCCCCTA
GACGGCGGCATCATCTGCAATGTCGGCGACACGCTCGACTTCTGGTCGGCCGGGTACTTGAAGTCGACCATCCACCGTGT
GATCCGGCCGCCGGAGGACCAGGCAAGCCAGTTCCGGCTCGGGCTGTTCTACTTTGTGCGGCCCGGCGACGACGTGGACA
TCAAGCCGGCACCGTCACCACTGCTGAAGCGACTCAGACTAGTGCGAGAGGATTCCGGGGAGGCAGAGCTGGTGACGGGG
CTGCAGTATGTCAGGGAGCGGGTCAAGAACTATCATGATCATGACGACTACACAGACAAACGTGGGCAAACATTCAAGCT
TGGCAGTCTGGAGATTGAGGACCAGGCCGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62