GenePrediction:GLEAN_3138 Details

Name: GLEAN_3138
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:409127..410890 (+ strand)
Length: 1764
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:409127..410669 (+ strand)
Length: 1543
Type: CDS
Source: GLEAN
Position: GCSC_161:410733..410890 (+ strand)
Length: 158
>GLEAN_3138 class=GenePrediction position=GCSC_161:409127..410890 (+ strand)
ATGCTTGCCTCTCTCTCCACTCTAGTGCTTGGCGCCACCGCTGTCTCTGCGGCCGTGGTTGCCCGCCACAAGACACAGCA
AGCCCCGACGGTGACGGTCAAGAACGGCTCGTACTACGGCGTTAACCTGCCGCATTACAGCCAGGACCTGTTTCTCGGCC
TACCATATGCCCAACCGCCGGTGGGTGAGCTGCGATTCCGCGTGCCACAGTCACTCAACAGCAGCTGGACTGGCAGTAAG
AACGCGACAGAATACGGGCCGCAGTGCATAGGGTACGGCAGTGATAATTGGGTTCTCGGCAACATCGTGTCGGAGGACTG
CCTGACCATCAACGTGGTCCGGCCTAGTAACGTGCAGGAGGGAGACGATCTGCCGGTGGCCTTTTGGATTCATGGCGGTG
GCTACACCGAGGGAGGCGGTCGGGACCCGCGCTATAACCTCACGTTTATCGTGCAGCAATCGGTCAAGGTCGGCTCGCCT
ATGGTGGCTGTCAGCATTAACTACCGCCTGGCCCAGTGGGGCTTTATGTACAGCCAGCAGCTGGCCGACGAAGGCTCGTC
CAACCTCGGTCTGCGCGATCAGCGCCTGGCAATGCACTGGGTACAAGACAATATCGGTGCCTTTGGTGGAGATCCAGCCA
AGGTGACCATTTGGGGCGAAAGCGCGGGCGGCAACAGCATCGGCAACCAGCTGGTGGCCTATGGGGGCCGTGATGACGGC
CTCTTCCGCGCGGCTATCTCGCAGTCTGGGGCGCCTACAAGTTTGATGCGGTACCCGACTCCGGGATCGTGGAAGGACGC
GTACGAGGCGTATGTTAATGCAAGCGGATGTGGCACCGCTGCCGATTCGCTGGCCTGTTTACGGACAGTTCCCTCAGACA
AGCTGTCTGCTTTGTTCAACAGCAGCACTATTACAGTACCCTCCGAGGGTCCGGTTGTCGACGGCGACTTCCTTACGCAG
TCGGGCACTACGGCCTTACGCAACGGCCACTTCGTCAAGGTTCCTTACCTAATTGGTGCCAACTTCGATGAAGGCGGCAG
TTTTGGCTCCAAAGGCATCAACACCACCGATCAGTTTATCGGCATGGTCCTCGATGAAGGGATCGACAACACTACAGCCC
TTACCCTGGCGGCCCTCTACCCTGATATCCCTGCCGTCGGCATTCCGGCCACCCTTCATGGCCGTCCGCCCGCCAGCGAG
CTGGCCACGTATGGCTCCCAGTGGAAGCGCAGTGCCGCCTACAAAGGCGATCATCTTATGCATGTCGGCCGTCGCCTGAC
AAGCGAGCTCTGGACGCAGCATAATGGCACCCTCTGGTCGTACCACTTCAACGTGCTTGTTCACGGCCTCAACCCTCTTG
TTGGTGCTGCCCATTTCCAAGACGTCGTCTTCGTCTTCGACAATACCCAGGGCCTTGGCTACGAGAATGCCGTGTCGGTC
AACCCCTTCAAGGATGAGCCGGCCACCTTTGTCCGCCTGGCCCAGACCATGTCGCGCACGTGGGTGAGCTTCATCACGAA
GCTCGACCCGAACGCATTGCAAAGTATTCTTTCACGTGATACCTAAGTTTATCCTACTCTCCGTCTCTGTGCTGACACAT
CAACAGCTTCTCCCGTGCATTGGCCCCAGTACTCTTTGGATAGTCCTCAGAACATGGTCTTTGATGTCAATGCCACTGAC
GTAGCTTACATCGAGCCAGATACCTACAGAGCTGAGGGGATAGCCTACATTGGCTCTATTTTCGACACGGTCTACGGCCG
TTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62