GenePrediction:GLEAN_3139 Details

Name: GLEAN_3139
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:421975..424619 (+ strand)
Length: 2645
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:421975..422317 (+ strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_161:422367..422634 (+ strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_161:422709..422838 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_161:423341..424359 (+ strand)
Length: 1019
Type: CDS
Source: GLEAN
Position: GCSC_161:424427..424619 (+ strand)
Length: 193
>GLEAN_3139 class=GenePrediction position=GCSC_161:421975..424619 (+ strand)
ATGTCGTTCTCTCTTGATGAGTTCGACTGCTTCTCGCTATCGATGGCATCGGGAAGCACCTTGGACACCGACTTTGGTGT
CGTCGTCGTTGACAGTGACGGCGATGGCGCTGCTCTGCAGAGGCCGTTTGATGTCTGGAGTTATCTCGGCCTTCAGTACT
CTCTGAATTCAACACCGCTGGACGGGATGGTTGTGTACATCAGTGTGGGCGCGCTTTTAATCATCACTGTCCTCCTCGCC
CGCACGCACCCAAAACAGTCTGTGTCTTTTATTTTCACCGATTACGTCAACCAGACCGGCTGGAAGTCGGAGGCGTGGTT
TTATTCTGGGTCTCCTGCCAGGCGTGAGTTCCGTCAACGGTTTTGACTCCGTGGCCCACTTGTCCGATGAAGTTATGGAA
CCCAAGGAGAATGTGCTTCGCGTAATGATGGGAAGCGCTTTTCTCAGCACCATCGCCGGTTTTCCCATGATATTCGTTCT
CATGTTCTGCATCAAAACCCCCGACAACCTTCTCGCTCCCATCGGTGGCCAGCCTGTGTCCCAGCTTCTTCTCGAATCGC
TTGATTTTGAGGCTCTCGCCATCATTGGACATCTCATCTACACCGTCTGCATGTTTGCCGCCACCATATGCACCTTGCCT
GCCCCTTCTCTTGTCCTCTGGTCAACATCTCGACAAGGCTGCTGTCCATGCTCCCGCTGGATGAGCGAAATCAACACACA
CTATGATCTTCCAGTCAACGCCATCTTTGTGTGCTTTTTATCGTGGTCGCTCTTGGATCGATCCAGATGGGCTCTACTGC
GGCAATCAGCGCCATTTTGGGTGGCGGCATAGTCTTGCTGTACGTGGTGTATGAGATTGTCCTCGTCTGTCTCTTGATAA
AAAGGCGAGCCGAATCATTTCCCGGGGAGCGCTATCTCAACATGCGCTGATTCGGGCCCGTCTTTTACATAATCTCCATA
GTCTGGATCCCGTTCACTGCCATTTTATTGTGCTTCCCCGCGTACCTTCCTGTGACGAGAACCTCGATGATATACGCCTC
GGCACTGTTGATGGTGATTTTCATGTGCGCCAAATGAACTGGTTTACGTATTCACGGAAGCGATATGTCTTGAGGTCTAG
CTTGAGATGTGCATCTTCGCTCTCGTTTTGTCGTCTGCCAACTACGTCCAAACTGCAGGTGTCTGCCGAGGTTGTTTTGC
CTGACCGTGTGCAAACAATATACACTGTGCCTCAAACATGCTGACATCGTCTACGTCATCCAGTCTCCGCACGCCATCTG
TTTCCTGCAGCCGTTTACCCTCCAGCATGGACTCTATCTAGACAACGACGAAAACTTGTAATTGCGACACTATGGATTGG
GTTAAGCGGGCTTCTAAGAAGGCGCAGCAGATGATGAACGAGCCGTCACCGGGCCAAGCAAGCCACAGTGGCGAGACAAA
CGCACAGCCAAATGCAGCCGAACAGCAGTCGGCGTCGCCGAGCTCACTGAGCCCTCCGCAGCGCACCGGAGACATCACGA
CACAGGTGCGACTGCTGGGACGACAGGAGTCCAACTTCCCCCACATCTTCCGCGACGGTGGCGGTGGCGGCACGGTGAGC
GGACAGGATCTGATCATCTTTGCGGACGGCATGTACACGCGAGGCCCACCGCCGACAGACCCTTCGCGCATGGTCAACTT
CATCTCCAACTCGATTGCGGTGCTGGGGCCGAGCGGTGCGGCCACGACGACCATTCGGCGTGTCACCGACACCGGCTCGG
AGGCCAAGGGCCCGGATCAGGCGCTGCCCTTTCTCGAGGACCAGGGTGAGACGCCGTCGAGCCATGCTATCTGGCCAAAC
GAGAACATTGCGACCATTCAAGGCGGAACCATCGGCGTGACATTTTCCGAGGTGATCGACCGCCGCCTCTTCCGGCAGCA
GAAGCAGGCGCTGCTGTACAACACGCCGATCGAGATCCACGTGCAGCAGCCGCATGCGGCCGGAGACGCCGCAGTCGTGT
CAGTGTCACGGCCTCACAAGAGCTTGTTCCTGGTTGGCGAGCCAATGTTTGGCTCATTCGTCACCTACGCCACCGACGAC
TACCTCTACCTGTTTGGGCGCGTGTCGGAGACCGACAATCCGCGCAGCAACGGGCTGAAGCTGGCGCGCGTAAGGCCCGC
TGACTGGGCCAACCGGCAGCTCTACGAGTACTGGAACGGACAGGCGTTTGGGCCGGAAATGCCGGCGCGCGACGACAACG
GTGCTGCCAACGTGCTGTGCTACACGCAGGAGATATTCGGGAAGCACTATGGCCCCGGCGCGGGCGACATCTTTTGGAGC
GACGTGTACAAAGAATACATCCTGCTCTTCCAGAGCGCCGGCGCCGCTTTAGACGATAACTGCAAGTTCATCCTGAGAAA
TGAGGAGAAGAAACACCGCATGCTAATGCTTCCCAGTGTACCTCTGCCACAGCCACGCGCTGACGGGCGGCTGGTCGGCA
CCGGAATCAATCTTCAAGATCCCCCGGGCCTCTGACGGTTTCAGCTATGCCTTCCATGCGTATCCAAATATGAGCCCTGA
TGGCAAGGTGGTGCCGATTACGTGGACGCAAGACTCAAAGTCGCAGTCGTGCTCCATCTATACGGGGGAAATCGTGTTCA
CGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62