GenePrediction:GLEAN_313 Details

Name: GLEAN_313
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:971876..973474 (+ strand)
Length: 1599
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:971876..972140 (+ strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_167:972205..972510 (+ strand)
Length: 306
Type: CDS
Source: GLEAN
Position: GCSC_167:972579..973474 (+ strand)
Length: 896
>GLEAN_313 class=GenePrediction position=GCSC_167:971876..973474 (+ strand)
ATGGGTCTCGACGAGTCGCCAGATTCGAGCGCTGCCTTGAACGGACTTCTCATTGGGTTGCTTTCGTCCCTCGGCTCGGC
TTTGGTTATCGCCCTTGTTTTTCTTGCCATCTACTTCTTCCGATGCACCGCTTCTGGTCGCATCTTGCTCGACAGAATTG
GCCGCCCCGGCGAATATGACGACGAGCAAGCTTTTCTACGGGAGGAGGAGGAGGCCCTCGAGTCGATGGACGATTTGCAG
CGGACGGAATATTTGAGAGCCAAGGGTGTGTCAAGCTGTGCCGTGCTTCTTTGTTGAGCTGTTGCTAACCCCATCTTTCT
GTTTGGCAGCTTTTGTCACTGCAAATCCACCCGAATCTGTGCAGACAGACATCTCACTATCGCAGTACCTGGCCATTCAA
GAAAAGGGAGTCTCTGCATGGGAGTTTGAGCCCGAGCTCGAAATTGCGAACTGCTTTGTGGAGGCCCGCACGGAGATTGA
ATTCTTTGACTCCGAATGCACTGTCATGTGCAATTTGCCCGTACCCAAGCAGAACGAAGTGTACTATTGGGAGGCCAAGA
TATTCGATAAACCCGAGAACACTTTGATCAGCATAGGCATGGCCACGAAACCATACCCTTTGTTCCGGTTGCCAGGTATG
TCATGCTCGCGTCCGATTTGGAACAAGAAGTGCGGCTCCAACTAACATGTGTTCTTGCCATAGGCTTTCACAAATATTCT
GTTGCGTACTTATCGAGCGGCCACCGCCGCAATAACCAACCGTTCTCTCCGTCTTCCTATGGTCCCCAGTATGTGCAGGG
CGATGTTATTGGCGTCGGCTACCGACCGCGAACGGGTACGATTTTCTACACGCGCAACGGCAAGAGGCTCGAGGATGTGG
CACACGGTTTGAAAACGCACAACTTCTTCCCGGCTGTGGGCGCAAATGGCCCGGCTGTTGTGCATGTGAACCTGGGCCAG
GCCGGCTTCGTTTTCGTCGAAGCCAACGTCAAGAAATGGGGCTTGGCCCCAATGACGGGCTCTTTAGCGCCTCCGCCGCC
TTACGGCTCTGAGCAGGGCAGCATTCTCCTGGAGACTGGCAGCAAAGACGGCTTCAGCAGCCTTCCCCCCCGCGGCCACG
GACACAGCCAATCGGTCCACACGTACACCACCAACCGGCCGCAGATGCTCGATCCCGGCCATAGCCGATCAAGGTCTGGC
ACGTTCCGCGTGCTGCCGCCTACGAGTCCAGGCCCGATACGCAGCCCGACAGATATCTCTCTGGCCCAGTTGGTACCTAC
AGACGAGGCAGGCGAGGGCAGCAGCAGCATCACCACGGGTCAAAACGGGCCGTCAGTCGGACTAGGCCTCCAACATCCGA
ACAGCCCGCCACCGCCGCAGTACACGAGCCCTCCACAGTCGGAAGACGGCGACAGTCGGCGCAGCAGTACAGATAGCGAG
GACGCTAGCCTATTGCGCGGCGGACGCAGTCGTGGCACGTCTTCTGCCACGATAGTCCGCGTGAACTCCCGGAGCGGACC
GCCGATTCCGAGCTACCGCGATGCAGTACGCCAGGGTGCCGGGCGCGATCGGAGCGACAGCGCAGTGTCTGGCCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62