GenePrediction:GLEAN_3140 Details

Name: GLEAN_3140
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:426924..428356 (+ strand)
Length: 1433
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:426924..427251 (+ strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_161:427315..427492 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_161:427561..428356 (+ strand)
Length: 796
>GLEAN_3140 class=GenePrediction position=GCSC_161:426924..428356 (+ strand)
ATGGATAGTCCGACGCCCACTAAAACGCCCAAGGCAGCACAAGTCTTGCTTGCAGATGGCACAGAACCGGAACCGGAAGT
CTTCAATCATGGCGTTGATCATCGCCCTGCCCTCAACGGCTCTGACGACGATGACACAAACCTGAGGGACGGCGCTGCTC
TCGCTGAAAACAGCACAGTGCACTTGGATCGGAGGGTACGGCTCAAGATAGACCACCGGCTGTGCACGATAGCAGGAATA
CTGTGCGCGATGGACCTGATCGACGGCAGCATCATGTCGAGCGCATCCGCTACATCAATGCCGGCATATCTAGGACTCAC
GGGGAACCGTTACTCGATGGCGATCTGGCTATCCACGCTTGCACAAATGATATTTTAGCTGCCGAGCACAGTCATCATGC
GGCTGGTGGGAGCACCGCTGTTCTTTACCACCAGCACTGTCGCCTTTGGCCTGATTACGCTGTGCATGGCCTATGTGACG
ACTTGGAGGCAGATGCTTGCGCTCCGATTTTTGATGGGCATGGCCATGGCGGGAATTTATCCGGGCCTAACCTATCTCTT
GTCGGCATGGTAAGCTTTCTCACCGCATGACGGGGGGAAGTATAGATATGGCGTAAATATTGACTGCAACAACACAGGTA
CACTAGGAGAGAGATGCAGCTCCGGTTTGCCTACCTTCAAAGTGGCCAGGTCATCATCGTGGCAACAGGCAGCATAGTCA
ACTACGGCCTAACTTTTCTTGATAAACAGCAGGGCCTCCGCGACTGGCAATGGATGTTCATCGTCCAAGGGGCGATTAGC
ATGTTCTTAGGTCTTGTGACCTATTTCTGGATCCCCGACTTTCCAGAAAACGCCAGCCGCACATCTCTGTTCTTGTCGCC
CCAAGAGGCGGCCCATGTGCTCCGCCGTATTGACGAAGACCGCAAGGACGCCGGTGCCCCGGAGCCGCTGACCGCGCGCG
CAGTATTGGAGCCGTTCCTGGACCCCAAGCTGCACGCCTTCAGCCTGCTCTTCTTTCTTCAGAACGTCGTCTCCACCGCG
CTGTCATACTTTATCCCTACCATCCTGCTCGGCATGGGCTTCACGTCCGCTGACTCGATCCTGCTGTACGCACCACCGTA
CTACTACGCCGTCATACCTGCCATCATCTCGGCCTTGGTGGCCGATCGGCTTGCGGCCAGAGCACCCGTCGTGGTCTTCA
ATGCCGTGTGTCTCATCGCCGGGATGGCCATGGTCGGATTCGTGCACGGGAACGTTGCAGCCAGATACGTGGGGGTCATG
TTGGCTACGGGTGCGTACGTCTCCAATTGGGCCGGGCCGAATGCCTACCAAACCAGCAACGTAACGGGGCAATGGAAGCG
TGCTACTGTCGCTGCTGCCGTGTCGGCTATGAATGCGCTGGGCGGCATAGCGGGATCATACATACTCCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62