GenePrediction:GLEAN_3143 Details

Name: GLEAN_3143
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:439112..441085 (+ strand)
Length: 1974
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:439112..439348 (+ strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_161:439402..439483 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_161:439545..440374 (+ strand)
Length: 830
Type: CDS
Source: GLEAN
Position: GCSC_161:440438..440621 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_161:440680..440866 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_161:441052..441085 (+ strand)
Length: 34
>GLEAN_3143 class=GenePrediction position=GCSC_161:439112..441085 (+ strand)
ATGGCCGCGATCAGCAGCGCATCAGAGAAAGGTGTCTTGGGCCCGGATGATTTGGGCGAGATTTTGAGCATTGACGTGCC
CAAATTGGCGTCGGAGGAAGCCCTCGACGATGTCTACCAAACGTACAAGTCGGCCGCCCTCGAAGACGTTTCGCCAGAGG
ACGAGCGGCGGGTTCTGCGCAAGATCGACCTGCGCGTGGTGCCGATACTCTTTGGCACATACCTGCTTCAGTACCTTGTC
CGTTTCGTCCTGTCCAGGGTGATGGTCAGCCAGACTAACGCCAATTACAGGACAAAAACTCGCTGAACTTTGCTAGTGTG
TACGGCCTGAAGAAGGCGACACATCTCAAAGGCCAGGACTACTCCTGGCTGGGTAAGCTGCAAGGTGTTTGGCGATGGCG
ATGATCTGCAGGATAGGCCCTAACGCGTCCCAGGCAGCATCTTCTACTTTGGCTACTTGATCGCACAGTTCCCCGGATCC
TACCTGCTGCAGAGGCTGCCAATCGGAAAGGTCGTCTCCATCGTGACTATTCTCTGGGGTGGCATCGTGATGACCACCCC
GGGCTGCAGCTCGTTTGCCGGCATGTCGGTGAACCGCTTCTTCCTGGGCGTCACCGAGGCCGTGGTCAACCCGGCCTTTG
TGCTGATCATGTCGACCTGGTACACGGCCACAGAGCAGCCACTGCGGCTGGAGTCGTACTACTGCACCAACGGCATCGCC
ACCATGTTTGGCGGCCTGATCGGCTATGCCGTCGGCCACATTTCCACTGGCCTGCCCAAGTGGATGTACGTCTTCCTCAT
CTTCGGCTCCGCGAGTGTCGCCTGGGGCGTCGTGTCTCTCTTGGTTCTGCCGGACCTGCCGTCGACAGCGCGCTTCCTCA
ACGAACGCGAACGCGCCATCGCCATCAACCGGGTCTCGCAGAACAAACAGGGCGTCAAGAACCACCATTTCCGCAGCTAC
CAGGCCGTCCAGTGCGCAAAGGACCCCAAAACCTGGATCCTCTTCGTCATGGCTGTCGGCGCCCAGATCCCCAACTCAGC
CCTCACCAGCTTCACCAGCATCATCGTCGGCACCTTTGGCTTCGATACCCTCGGCACTCAGTACATGCAGATTCCCGGCG
GCGCCGTCCAGTTTCTCGCCCTCATCATCGGTGGCTGGGTCTGCACCCGCTGGTCCAACCTGCGCTGCATCACCATGATC
GTGGCCAATACCATCTGCATCATCGGCGCCGCCATGCTGGTGGGACTGCCAAACGACAGCAAGGTCCGTTTGCTTTCGTC
CATTTCCGCTCACGTAAACACTGCTGACTAAACCCGCCTTCTTCAGTGGGGCCGTCTTGTTGGCCTTTGGCTTTGCTACT
TCCAGGGCCTCGGCTTCAGCATTTCACTGACGATGGTGTCCTCCAATGTTGCTGGATACACAAAGAAGCAGCTGACTGGC
GCTGTCCTCTTCACAGGATACTGTGTGGGGAACATCATCGGACCACAGACTTTCAAGTCCAGTGAGGCTCGTAAGTACTC
CGTAGCTTTAAACCTCTTTGTACCAGCAGGCGCTGACTAAGCCATCAGCTCATTACCACAGCGCGTACATTGCCATGCTG
GTGGGCTACACAGTCAAACTAGTCATGGTTATCGTGCTGTACATCTACATGTACCGCAGCAACAAGGCACGTGATGCTGC
AAGTGTGTCCGACGACAGTACGGCTGTCGAGATGGGCATGCTTGACCAGACCGAGCTCGATAACAAGGGGTTCAGGTGGG
TTTGCCCCTTCTGGCAGTTACCGAGTTGTACTAACAGTGTTAGATACGTCTTATGATGAAAGCGTGCTTTTCCTTGTGAC
AATCACGATGGTAGAAGATTTGTCTTTTAAAGTGATAGTATAGAACGAATATACATGCTTTCTATCGTGCTTCGCCTTCG
TCAATGTGCTTTTTTCGTAGGCTCTACCTTGCTGAGGACTCTACCCCGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62