GenePrediction:GLEAN_3144 Details

Name: GLEAN_3144
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:442053..444625 (+ strand)
Length: 2573
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:442053..442589 (+ strand)
Length: 537
Type: CDS
Source: GLEAN
Position: GCSC_161:443208..443473 (+ strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_161:443545..444625 (+ strand)
Length: 1081
>GLEAN_3144 class=GenePrediction position=GCSC_161:442053..444625 (+ strand)
ATGGAACACCTTTCTCCCGTCGGCGCCTCGCACATCAACATTCCATATCTTGGGACCGAGTGGTTCGAGGCAGGCTGTTT
GCGCGACTGCTCAGAACTGGAGAATTTTAAGGGCTATTTGCACCGCAAGAATTGGGTGCTTGACCGAACGACGGCGCGCT
TGGTCTTCGGGAATCGAGGCCCAGACGAGATTGCTGAATTTCTCCAGACGGCATTCTACTTTGGGTGCCTCATATCTGTT
TTCCGGACGGTGCAGATTCCGATCCAAACCAGCGACTTTCTCGAAAACTGTTCCAAGACTGGGAAGATCTTTGTTCGCAC
CACTCGGTTGCAGGCTCTCATAGGCGCATGGATTGCGTTTGAAGAATCCGCGCCGACGATGAAGACCAGCTCAAAGTTTG
ACCGCGAGCAAACAATCAGCGAGATGCTCAACTACACATCCTATTTTCTCACCTTGTTCAGCGAGAAGAGTCAGGACATG
TCTGAGCCCCATAAGAGTCAAATGCACCTCATCGAGCTGTCGATTATGGCCCTAGGAGTCTTGGCTCCACCTTCGCTGTC
ATACATGGCCGAAACATCCAGGACATGCCGACATGGGGGCACAGCTCCATCTTGAAGGCGCGGTTGCTAGAAAACGAATG
GTGCGTAAGCGACACGCCCTTCTTCCCCGAGTCTACGACAAGAGCTGCCATCAGCGCCGAGTATTATTTTGGAGGACGCA
AATGTCCACGGCCTCGTGACGGCCATTCCGAGTGCATGGCGACTATTTGTAAAGCATATCTCGCCAATGTCGACGAAAAG
ACATATGAACAGACACATGCGCTTCCCGGTTGCCTCTGTTCGGCCAACGAAGTGCCGCACGAAGACATCTCTCGCATCGT
TTCCACGGAGACTCCCTTGGTCAAGAATACCCCCTTAGTGAGATGGGATAACAAAGCTCTGACTGTTTCTGTCGCTGGTC
CTCAGACCAAATATGTGGCAATTTCGCACGTGTAAGTAGAGTTCTTTCCCAAGTACCCCCTTTCTTCTCGGTGATGCAAG
CATCTGAGTGTATCGCTGTGTCTATGTAATAACCATCCGTTGTTCCCTCAGCTGGTCCGATGGTCTGGGCAGCCGAGAAA
ACGTGCTCCCGACATGCCAATTGACTCGCATACAGTCGCTAGTCAACAAGCTCTACAAGGAGCCGCACCGGTCATCAAAC
CACGACATGCTCCCGGCCACTATCCACCAAAGCGACGACGACGATGATGACAACGACATGGTGCCCTTCTGGATAGACAC
GCTTTGCGTCCCGTCCTGGGATAAAGACCTGCGCAGAAAGGCTATCGAAAACATGGGTAACATTTGCCGCAGGGCAGATC
GGGTCCTTGTGCTCGACGCCCACCTCCTCTGTCTTCCTCGCTCAGCCGACATTGTGGAAAGGTACGCAGGCATCCATCTG
TCGAACTGGCATCACCGATTTGGACCCTGCAAGAGGGCCAGCTGGCGCAGAGTCTCTACTTCCAGCTCGCAGACGGGGCT
GAGTCGTTTTACGACACGAACTACGTCGAGCTGCAGCGCTTCGATCCCAGGCTCCCGGAAATTTTGTGTTCGCCCCTGCG
GAGCCTCTGCGCCCGGGAGCTCGAGGCATTTTATCGGTACGATGAAGGAAAGGCAGCTTACCGTGGCAGTGGCAGTGAGG
GTGACGGCGACGGCGACGACCTCCCGGCCCGGATGCGGTCCTGTGCAAAGTATCTGGGAAGCCGACATACCAGCCGATCC
GCAGACGAGCCGCTTTGCGTGGCCACAATATTAGGACTGAACCCTGGCAAGCTGTTGGAGACATCAGACCGTGTCAAGCG
CATGGCCCGTTTCTACGACCTCGTCGGCTTATTCGACCCCCGCATCATCTTCCACGAGCACCCGCGCCTCCCCGAAGAAG
GCCATCGCTGGGCCCCGAGCTTCTTCTTGCAGCAAACTCCCGATATCATCACCTTGCGCGAGAATTCCTTCCTTGACCTG
CCACCGGTGTCTATCATCCCCCTCGGCGGTGGCCTGCCCGTTCAGCTGGCGGGCTTTGATATCAGCGGCCTCCCCGAGAC
GGCCACGTTGTGCCAGGCCGGCCGTTCTCCTATATATTTTCGGCCAGAGACGCCCGTCCCCGTGCCTCTGCAACAGTGGT
CGTGGGCACAGAAAACGGTGTGGTTTTCGTGTGCGTACACCTTAGAGCTGCTCCCGGATGCCGACGGGAAAATGCCGAAT
ATCGGAGACTGTTCGAAAAAAAAAGAGCAATACGCCGCCATCTTGCCGGGGTTCCTCCATCCGGACTACCTTCCCGCCAT
TGGGGTCTTGGGACTCATCGTCGCTGACGGAAACGGAACAAGAGAGGAGAGCAAGCTTAATAAGAAAGACTGGACAAAGG
GTAGCGGCCGGCCTGGTAACCAGATTTCGGCTCATTTGGTGCCGTGGAGGATCTCTGTAGATTACGTCTGTCGTGTGCGT
GTGAGCTTGCCGCCGGCAGAAGCGATTCCGCAAGACATGTCTTTTGTGACCGGGAAGGCTTTTGGCTGGGATCAAAGTTG
GTGCATTCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62