GenePrediction:GLEAN_3145 Details

Name: GLEAN_3145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:446426..448055 (+ strand)
Length: 1630
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:446426..447282 (+ strand)
Length: 857
Type: CDS
Source: GLEAN
Position: GCSC_161:447404..447455 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_161:447516..448055 (+ strand)
Length: 540
>GLEAN_3145 class=GenePrediction position=GCSC_161:446426..448055 (+ strand)
ATGTCTCCTAACGCTCTCCCTTCCATGGATTTCCGCACCTTTGTCGACGCTCTCAAGGCAGACGGTGACATTGTAGAAAT
CAACGAGGAATGCGATCCCTTCCTGGAAGTCAGTGCCATTATCAGACGAGTAGTCGAAAGTGACGAGAAGGCACCGCTCT
TCAACAATGTCAAAGGACAGAATGAAAACGGCCTCTGGCGCATTCTCGGCGGCCCAAACTCCCTTCGTTCAGATCCCGCA
ACGCGGTACGGCCGCGTGGCCCGTCATCTCAACCTTCCGCCCACGGCATCGATGAAGGACATACTTGGCGCCTTGACTGC
GGCCAAGTCTCGGCCTCCAATCCCACCCACAGTCGTCGAGACAGGACCGTGCAAGGAATACAAGTTGACCGGGGATCAAA
TCGACCTCAACGCCCTCCCGTCCCCACAGCTCCATAAGGGAGACGGCGGAAAATACGTGCAGACGTATGGAATGCATATC
GTGCAGTCGCCAGATGGCACGTGGACTAACTGGTCGATTGCTCGCGCCATGGTCAACGACAAGAACAGCCTTGCCGGGCT
CGTTGCTCTGCCGCAGCACATTGCCCAGATTCGGGAGATGTGGAAGGCCAAGGGCCAGGATATGCCATGGGCTCTTGCTT
TCGGCGTCCCTCCCGCAGCGATTATGGCTGCCAGCATGCCGCTCCCTGACGGCGTATCGGAAGCCGAGTACGTTGGATCC
TTAGTCGGTGCCTCTCTGGAGGTTGTCAAGTGCGAGTCCAACGGGCTCTACGTGCCGGCCAACTCGGAAATCGTCTTTGA
GGGGACCTGCTCCGTTACAGAAATGGTGCCAGAAGGGCCCTTTGGTGAGATGCATGGGTATGTGAGATGCTAGTAAGCTG
CTATGGTCCTCTTAAAGTGTGCTAACATTCGAAAGTTATGTGTTTCCGGGAGATAAACATTCTGGGCCGAAATTTACCGT
CGACGTTGTTACATACAGAAAGGATGCCATTATGCCTGTCTCGAGCTGCGGACGACTAACCGATGAAACCGTACGTAAAA
TTTCTGTTTAAAGAAAAGAGTAATTAGGCGATACAGCTAACACGAAATAGCACACGATGATTGGTCCGCTTGCGGCCGTT
GAGATCGGCTTCCTCCTTAAGTCCAATGACTTCCCCGTCAAGGAGGTCTTTGCTCCCTTTGAGTCCCAGGCAACCTGGGT
TGCTATTCAGATCGACGGTGAAAAGCTCCGGGCCCTAAAGACAGATGCAGAAACGTTCGCCCGCAAGGTGGGTGATTTGG
TGTTCCGGAACAAAGCGGGAGCAACAATTCACCGTCTTCTGCTTGTCGGTGATGACATTGATGTCTACAACTTTAAAGAC
GTCATCTGGGCCTATACCACGCGGTGTCGTCCAGGCATGGACGAGTACTACTTTGAAGATGTTCTCGGATTCGCCTTGAT
TCCGTACATGCTGCACGGGAACGGGCCTGCCTGGAGAGGTGGCAAAGCTGTTTCCGACTGTCTTCTTCCGTCCGAATACA
AAAATGGGCCGGACTGGGAGACGGCCGACTTTGCGCACTCGTTCCCTATAGAGATTCAAGAGAGGGTGAACAGCCGCTGG
GAGGCACTAGGGTTCGGCTGCTCAAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62