GenePrediction:GLEAN_3146 Details

Name: GLEAN_3146
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:453821..457067 (+ strand)
Length: 3247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:453821..453915 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_161:454001..454379 (+ strand)
Length: 379
Type: CDS
Source: GLEAN
Position: GCSC_161:454549..455161 (+ strand)
Length: 613
Type: CDS
Source: GLEAN
Position: GCSC_161:455242..455296 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_161:455653..456203 (+ strand)
Length: 551
Type: CDS
Source: GLEAN
Position: GCSC_161:456268..457067 (+ strand)
Length: 800
>GLEAN_3146 class=GenePrediction position=GCSC_161:453821..457067 (+ strand)
ATGCGCGCCCAGGTGACCATGCCTGTTCGCGTGCTAGCTATGACGTGCCTGGTGGCCGGTTGCCTGGCTCTGGACACGGT
CCAATACGGTGCCTTGTACGTGTCACCCTCGTTCCCATGCATATGTCGATGGGCTGGTTCGTGCGGCCGCCCGTGCTGAC
TATATCTCGTCGCGTGGCAGTCTGCCCACGGCGACGTACTCGGTGGCCAACCAGCTGGGCTTCTTCGAGGCCTTTGGCCT
GGACGTGGTCTACAACCTCGTTCCCAACAGCGTCTCGGCCTTCAACTCGCTCCTGGATGGCGACTATGACATCCTCACCG
CCACCGTCGACAATGCGCTCAACTACCGCTTCAACAAGGCCGAGAACGTCACCGTGCTAGGCCAGCTAGACCAGGGCCCC
GACCTGGTCGTGGCCTCGATCCCATCCATCACCGCCTTCTCCCAGCTCAAGGGCAAGCCCATCATGGTCGACTCGCCCAC
CAGCGGGTATGCCTACCTGCTGCAGGACGTCCTGTCGGCCAACGGGCTGGAGCTGGCCAACGGGGACTACTACTTTATGG
TGAGCGAAGCAGAAGGCGGGGGAGAGAAGAGGAAAAAGAAAACTCCGGTCCCGGGAATACGAGAAAACAAGAGGCTTCTG
TAGCCACTCCCCCTTCAGCACTCCCCTCTAGCACTCCCCCTCTCCTCCACCCCTCCACCCCTCCACCCCATGCTGACGCC
CTCCACAGACGGTCGGCGGCACGGCCACGCGGTATGCCGCCCTCACGTCGGGCGCCCTGGCCAACGGCTCGGCTGCCTAT
GCGACCATCCTCAACTACCCCTTCACGGTCGAGGGTGCGGCGTTGGCGGCGGCTGAGGCGCCGACCGTCCTGGCCCGCGT
CTCGGACCTGGTGGCGCCTATCACGTCGAGCGCCTTCACGGTCAGCGAGACGGCCCTGGCTAGCAGCGCTACTGCCTCGC
TGCTGACCAGCTTCCTGGCCGCCATGCATGGCGCCAATCGCTTCCTGCTCGACAGCGCCAACCAGGACTGCAGCATCGCC
GCCATCGCCGCCCAGGTCGGCATCACCTCCGCTGTCGCCGCGTCCGAGTACTCATCCGCCGTCAACACCGTCTCGGGCGA
GATCGCCTCCGGTGGCAACTTCACCGTCAGCCACGACGGCATCACCAACGACATCGACGTCCGCACCAAGTTTGGCGGCT
TCGCCGGCCTCGCCGCCGACTTTGACTGGTCCGCCGCCCTCCAGCCAGGCTCTGGCCAGCTGATCGATTATGCCGTTCGC
GACGCCGCCATCCGCCTCTTCAACGAGCAACCCTACGCGGGCAACTGCTCCCAGTCAGCCAGTAAGTGCCGCCGTCGCCG
GCGGTCCGTCTAGGCCGTTGACTCGTTTTGTAGGCAAAGGCAACGGTGCAGGCGCGGACAGAGGTCGAGGCGGAAGACGC
CCGTAAAGGCGACGGTGGAGCGGAGGACTTCCATCGGTCTGATGCCATCGTGACATCCTAAGCGGCTACTTCGACAGTCA
CGTGATGGGGTTGTCTCAATCTTATTACGGAGTACTCCGTATACAATACCAATCACAATGTGTACCCGTACATCCGCTCC
TACAGCTGGGCCCAAAGGCAAATACAAGAGCTTCAGCTCCTAGGCTTGGATCCGCTTTCGTGCATCTACTGTTTCGCCCC
CAATCACCCGGCCGATGTGCCACGTAGGGCTGTTGGGCAACGGGTCACGTGCGGCTTGGACTCATGTCGATTTTTCTCCT
CTGCTTCTCAGTGTCTCTCTATTTCTCCCTTGTACCTCCATAATCCCTTCCCCTCATGGACATCTCCGACAGTCCGGCCG
CAACGCTGGCCGACTATCAACGCGAGGTCCTGCGACGAGGTTTCCGCGATGCTCTCGCCCTCGGCCAAGTCCGTCCTCTG
CTGCTGCCGTGGTGCATTGTGCCGTCCTTTGTTCTGCCGGCGCTATATCTGGCGCTGCCCCAGCAATACGGCCTTCAAGC
AGCCCGCATCCCCCTGGCCGTGGCCATCGTGGCACTCAACGTGAGCATGCTGCCATCGCCGTGGTGGCCGCCCGTGTCCA
GCCTCAACTTTGCTAGCGCATACGGTGCCGGTCTGCTCGCCGCCTGGGGCTCTCTCTGGACCCTGACAGTGCTCGTCTGG
ACAAATCCGCAGCGGGATGCCGAACGCGTCGAGAGGAGGCCGGCCTTGAAACTGGAGCGCAACGACATCAATGACATCAA
TGACGTCATGGCTCTGGATGCCAGCATCGCCCAGAGCCTCCAAGATGGTTCCGCCTACTTCTGGCAGTCCTTCCCGGCCG
ACCACTCCTTTCTCACTCGGCTCGACTGGACCCTGGACCTTGTTATGGCTTGGCGAGGAACTGGTAAGATACGTCTTGTT
GTTGCAGTGGCCCGGATGCTGACTAATCTACTCTACTCTGCTCTTAGGCTGGAATTGGTGCATCTCCCAACTGCCACGCT
TCAGACCTCCTCGACATGCTCACTCTGCCGAGTCTGTCGAGCTCGACTCCATGGCCATCCGGAGTGCTGCCGGCTTCCGA
CGCCACCGCAGCTATGCCGCCTTTGTCTCTTCTCGCCTGCTGGCCGTTGTCGCCGGCTATCTTGTGCTGGATATCGCCGC
CGTCGTCATGACGCTGGATCCCTTCTTCGTCTTCGGCTCGCTGCCCGAGCACCTCGCCCCAGACCTGCTCCACCTGCTCC
AGTTGCCCCCCGTCTTGGCCTTTGTTTATCGTTACCCCGCCCTGCTGTCGCTTTACCGCGCCTTCCTCTGCCTCGCTGGT
GTCGTCGCCGGCCTGTACATGTACCTCTCCATCAGCCATCTGGCACTCGTCCTCCTTCTGGGCCGTCGTGGACCGCTGCA
TTGGCTCACCGGCTCCAGCACCACGCGCGCCGAGCTGTGGCACTACCCGTCCATCTTCGGCAGCTTCAACCAGCTGCTTG
ACCATGGCCTCGCTGGCTTCTGGGGCGGCTTCTGGCACCAGACCTTTCGTGTCGCCTTTGTCGCACCCACTGCTTGGCTC
GTCCGTCTCGCTCTCTTGTCACCTCCCAGAGCCAGAAACGCAGACATCAAGACTGGCTCTACACATCCCGTTGGCCTCGT
CATCGCCTTCTTGCAGTCCGGCTTCTTGCACGCCGCCGGCAGTTCCACCAGTGCTGGCCGTGCTCGCTCGCTCTGGTGGC
AGCAACCCCTCTTCTTCGCCCTCGCCGGCGCCGGCATCGCTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62