GenePrediction:GLEAN_3147 Details

Name: GLEAN_3147
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:464112..471347 (+ strand)
Length: 7236
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:464112..469592 (+ strand)
Length: 5481
Type: CDS
Source: GLEAN
Position: GCSC_161:469667..470463 (+ strand)
Length: 797
Type: CDS
Source: GLEAN
Position: GCSC_161:470734..471160 (+ strand)
Length: 427
Type: CDS
Source: GLEAN
Position: GCSC_161:471231..471347 (+ strand)
Length: 117
>GLEAN_3147 class=GenePrediction position=GCSC_161:464112..471347 (+ strand)
ATGGACGATGGTGATCGAGACGAGGCCCGTCGGCACCTCCACCTCGACAGCTCGGACGACCGCGACGACCTGTCCGGCCG
CGGCCTCTCTGATCATTTCGACGGACAGACCGCCCAACAGATCGACAGCAGCAGCCGTTTCGATCCCTTCATCCTAAACT
ACTTCGGCCGTCCAGATCACGACAACAACAACAACAACAATAATAACAGCAGCAGCAGCCTGCCATACGCCCCCCTCTCG
CTCCTCCCTCCGTTCCAGCCTTCGTTGCTGCCTCCGGTCGCGTTCCATGGCGCCGTAGACCTGCCGGCACTCGACACTCC
TCATCCTGCCGTCCACTCGAACGCGTTGTCCGATTCTGCCGATTCCGTCGATCCCGTCGATCCCATCGACTTCTACCGCA
GCTACCCACAGCAGGACGCTCAATTCCACACAGCCACGACTGCTGCCGACGATGCCATGGCTCCCGCTGCGTCTGGCTCG
CGGCAAATACCCGTGGCTCGATTCCACGCCAATGGCCTCAGCCCAAAATCACCAACGACGATCCCCTCTTCCCTCCCTGG
CTACACCAACGGCTTTCGCTCCAACAGTCGATCCGTCTCCAGCCCCATCGACAGCTCCTCGCCCTCCTCCACCTCGGCCT
ACTCCAGACCGGCTCCGACCGCAGCCAGAGCCAGGAGCGTCAAGGACCTGAAAAAGCGCTATGACCAGATCGCCGTCCCC
TCGTCGCCTCCGTCGATCTCCGTCTCTTCCACCTCGTCCAGACTGCGACCGACTGCTCGGCCCTCGATGTCCTCCTCTGC
CTCTTCGTCTTCCCGCAGTCGATCGCCTGCTACCGGCGTAGGCACCGCGTCCGCCAATCGCGTCAAAAGCCCCGCCGGCC
GTCTGCGCCAACAGGCACCATCACAGCATGAGAGCAGTCCACAGTCGTTTGCCAGTCGCATTGCCAAGCCGTCGATGACC
CAGCTGTCGTCCCCCGTGTCGTCACCACCTCGATCTGCTCGCCGGATGGCCTCACCACCGCCACCTATGCCCTCTCTGCG
TACCAACGGCCTGCTCTTCGGAGAGATCCTTCCTGACGAAGCTGACGCTCCCCTGACTCTGGGCTACGGAATCAATACTG
TTCGCCCGAGACGAACTTCCGACTCGAGTGCCTACCCAGCACGGCCTTTTACGCGATCTCGATCCGAAGCCGGCGCCGAT
CCCGAGCCAGCATCGCCTACGGACTGGTACCGTGGCGTCCTGTCGACACAGGCGGCTGAAGCTACAGCTACAGCAAATTC
TACGAATCTTCCCATTGCGAGCTCCCACACACAGGCTGGTCGTGGAACGCGAATCCCTGCGAGCCACAGCCGGGCACATA
GCGACTTGGCCGGATCCAAGCCCAGAGATGTCCATACCCACCACCGGCAACGTGCCTTTGACCTTGCAGCTTCTGCCGGC
GCCGACCCACTTCCCTCCCATAGCCAAAGCGAAACTCCTCCACCCAGCTCGCCCCAGCAGCGGCTCCCCTCTTCTCCCAC
CTCTCGCCTCCCTATCTCCGTGAAGAAGCAGACCGATCCGTCTGCGCGCATCGGTCGCGCCATATCCCGATCCAGTTCCC
CCGGCCTTGTACGACGTCCAGCTAGCGCCACGAGCAGGTCTGCTCGCCAATTGTATTCACCCCCGGTCTCGCTCAATAAC
GCGAAGGCGCCTGCCAGACGAACGGCCACTCCCACAAGCCCGGCGTCTGGCCCGGCACGGTCGAAACCATCGACATCGTC
TTCACGAAAGCTGCCGCCAGCCCAGCTTGCAACCCCCAGCAGCAGCCGCCTGAACGCCTATGCATCCGTCCCGCCGGCAA
AACTATCGCCTACTCTACGGAGCTCGAGGCCGCGGCAGCCGGTGTCGTCTGCCACTGGCAAGATGTCGGCCCATGGTAGC
ACACGCGCATCATTAGCAAGACAGGAGGAAGCCGAGGCCCGACGGCGGAAGATTGACGTGGGCCCCATCGATTTCGCCAG
GCGCCGGGAGACGATCCGGCTCGCATACAGCAAATCCATCCGTGAGACCGAAGCAAAGGCCACCCGGCAAGCAGCCGCAG
AGAGAAGGAGGAAAGAACTGGAAGAAGCTGCTCGTGCCAAGGGGTTTGCCGAGGCTGCCGTGCTCGCACAAACGGAGGCA
AACAGACGGGCCGCCGAGGCCGCCGCAGCGAATGCTTCGACTGCCTCTTCCTCGTCGACGCGGCATTTTCCCTTGTCCGC
ACCTGTCACGGTCGACGCGGAAAAAACGCCAGAGTCTTGGAACGCGAATGTAGCAGTCGCCACTGGCGCCACAGCCACGT
CTACTAGTGACGAACCTGTGGGGAAATTGGCTGGCTCCAGGCTAAAGATCGTTACTGATATGCCAGAATCGCAGTCAGAC
AATCCCGACAAGCCCACGAAGCGAGACTCTCCTACACTTGGCATCCCCGGAACATTTCCCGATCCTCCCGTCCTGGGCTC
TCCGCCACTAGAGCCGGCACATGAGGGACCGCCGCGGTCTGCCATTTCTGCGCATTCAGGCGTCACCGAGTTCGACAACG
AGGCACAGACCGACCTGCCGCTTCGAGAATCCGGCACGGCTCCGCTGTCGGACGCGGCCTTCTTGCAGCAGCAGCAGCAG
CAGCAGCAGCAGCAACGACAACAACAACACGAAATCCAACTCGGGCTAGAACGTGAGAAGGCTGAATATCGCTCGCCATT
CGACGGGTCCTCGTCGGAAGACCCGCTTCCCCCCACAACTGAAGAAAATCAGCACGTCGAGAAGGCCTTCCGCCACAGAG
CAGTACTATACCGATTTCCCTTCCAGGTCAAGGTGGACAGCGAACAACCCTCCGTCGGGGACAGCTACGAGACTACACCC
GCGGATAGCATCACTGCCACAAGACCGCTTTCGTTCGTCAAAACCATCCCAGGGTCTTACCATGAGGAGAGCGACGTCAG
CCGGCCCGTCACGCCTGTTCTGGCGTCTTCTTCGATGGACGCAGGACACTTCAAAAGTCCTAGCCTCGATCTCGTTGGGG
AACATGAAACGCCCCGACGTCCGCCTAGGGATGAAGTTGCCACGTTGGAGATCCCGATCATCAACGAGACAAACCAGGGC
ACCGATAGCCTGGACGCAGAACCGATATCGAAGCCGCAAGCCGCGGGCACGGATGTGACCGAACAGTTCCTGTTTTTGCA
CCGCAGCTCTGCCGAGTACGAACCACAGCCCTTTCGATCAGAGTCGAACCACACAACTGTCACGATCCTCAGTCGCGAGA
CCCAGCTCGCACCGGCGCCAATGTCTCGCAAGAGCAGCCGCCTCACGATGCCCGAAGACGCCCGACTGGATGCTGTGGAA
GACTTTTACGTTGGTCCCAGCTTGAGAGATAACGTGTGGACGCTTCGCGACTCTGCCTTCGCCTCGTCCGATGTCTCGGA
CGACGCACGGCAGGCATCGGGCAGTGAGCCGCAGCAGACGCCCGATACGTCCAACAGTCTCAACGTGCCGCACTTCACGT
TTCCGGCGAACCGGTCTAGCCAGCAGTCCGGCTGGACGGACTTTTCTGTCGAAAGCGCCGATGCCCGCGAGTATATCGCG
GCCCGTGAGCTGGCGTCGTCGGCTGCGGCATACAACACCAGCCTCGACTCTGTCATGCGTGGCCAAGGCGCCGCGGCCAC
GACGCATCAGCCTCACGTCCGACAGCGGCACAACCAGCGGCGCCAAAACCATTTCCATTTCGACTCTCGGCCCGGCTCCT
ATGCGGATATGTCGGAGCAGAATGACGACTGCAGCGAGATCCAAGAGGCCGAGAGTGTCGGTGTGTCATCACTGGAGCAG
TCGGCGCAAGACATCTCGCTGTCATTAGACGGCACGGCTCCTCAGCACCACCGTTTGCCCGAGGTCGACACGGGCTCCAA
CTTTTACATCCCGTATCTGTCTCGCCAGTCGCCGGCCAAGAAAAGGCCTGCTCGGCCAGAGCACGACCCGCCGCCGGTCC
CTGTGCCATCCGAAGGCCACAACTCGTCCGTCGAGGCCAGCGGGCGGCCCAGCTCGTCGAGTGCCTACTATGACTCCTCT
CGTCCGAACAGCTACATACAGGGCATGGCTTTGCGGGACGACCAGTGCTCGTTCACGTCAGCGGCCGATGGCTCGATCAT
GGCCTCACAGCTGCCGCCAGTGTTCGCGCCACGGCCCTCGTTCGAGCAGTCGTCGCTGGATATGGGTCACCAATCGATCA
GCGGGGCTACGCTGGTGGACAATGAGCGGCTGAATGCCAGCGGGGCGGTTGAAAGAACGGTTGCCGACAGTCGGACGTCG
ATCGATAGTAGTATGACCGGTGGTGCAGCCGGCACCGGCAACAACGAGAAGCGGCCAGCACGCAGCAAAGAGCAAGCGCG
GCTCGTTCAGCGCCAGATGGTGATCCGAGAGCTCATCGACACCGAGGCAGTCTTTGTTCGCGACATGAACATTGTGGAGG
AGATCTACAAGGGAACGGCGGAGGCGTGTCCACAGCTCGATGACAAGACGGTGAAGCTCATCTTCCGCAACTCTGACGAG
ATCATTGCCTTTCACACGGCCTTTCTTGTCGAGCTCAAGGAGGCCGTGTCCAGCGTGTATGCGCCCAAGAGCACGCGACG
CCCCTCGCCAGCGACTCGCGAAGGCTCGACAGCATCAGATACGGCGACGGCAGCCAGTTCCATGCTGGCATCAGACAGCG
GTCCGGCTTCAGCCGAGACAGACGAAGACACGCGCGACCGGCAGACGCACCTCGGGCCAGTCTTCCGCAAGAACATTGAC
AAGATGCGGTTGACGCACGAAGGATTTCTCCGGAGCAGTGACAGTGCGGCAAAGCGGCTGATCCAGATCCAGGAGGATCC
GACGGTGAACGTGTGGCTGAATGAGTGCAACGAGGTGGCCAAGGACCTGACGGCGGCATGGAATCTGGACTCGCTGCTGA
TCAAGCCGATGCAGCGTATCACCAAGTACCCGAACCTCATCAGCCAGCTGCTGCAGTACACGCCGGCAGACCACCCGGAC
AGGCCGGCGCTGATGGTAGCGCGTTCGGCGCTCGAGACGGCGATCCTGGACATCAACAAGACCAAGAAGAACTTTGAGCT
GGTCGGGCAGATTGTCGGGCGCAAGCGCAAGGACTCGGACGTGCGCGCAGGCTTTGCACGGGCGTTTGGCAAGCGGGTGG
ACAAGCTACAGGCGTCCAACAACCGGCCGGCCGAGGACGCAGAGTACACGAAGCTGAACGAGAAGTTTGGCGACGACTAC
CTACGGCTGCAGGTGGTGCTGCGCGACGTGGAGTTCTACACGCGCCAGGTGACGGCATACGTGCACGAGTTCCTTCAGTT
TCTGTCGGCCATGGAACTGGTCATGCGGCTTCAGCCGTCGCCATACCCGGAGCTGGAAAGCAAGTGGGCGCGCTTCAATG
TATCCATGCGGGACATGGAGAAGGTGGCGCTGGACCAGCATGTGAGTGTTTCTCTTCGGCCTTGCCTCTCTTTCTGTCGC
GCTCGGTCTTGTCTAACTCGTGCCAGCTTGCCCAGGTACGAAAGCACGTGATCGAGCCGTTTGAGCAGGTGATCAAATGC
TACGGCAACCCCAGCCTGGCGATGAAGAAACGGGCCAAACGGCGGCTCGACTTTGAGCGAGCGGCACAGCTGAAGAAGGC
CAACAAGAAGGTGGACAAGCAGCTGGCCGAGCTGGTGGAGCAGTATGAGGCGCTCAATGACGCGCTCAAGCGCGAGCTGC
CGATGCTGTCGGCCAACACGGAAAAGATTGGCAACATCTGCCTGGGCAATTTCGTCAGCATCCAGGTGCGCTGGTATGCC
ATCTGGAAGGAAAAGGTGCGCGTCGTGCTCGACGACAGCCAACAGCAAGGCGTGCCGGAGATTGCCGATATTGTCGCCAC
CTTTACGCGCGAGTTCCGGGACATGGAGGAGCACATCCACCAGAATCTTACGATCCTGAACAGAGACGGCAGAAGCGAGG
CCACGGGCAGCATCAGCATGTCGCGATCGCGGTCCCGACCGTCGGACATGTCGCCACGCGTCCGCGCTGGATCCATCAAC
AGTGACAGCACGCCGTCCCTGCCGACGCCCGACTTTGGCCGGCGCAGCAGCGGCCATTTCGGGCTCGTGTCGCCCACGCC
GTCAGCACAGGCCACAGCCGCAGCAGCAGGTGCGTTTGCATCGCCGACAGGTGGCCCAGCAAACCCGAACCACTATTATT
ACTACCGCAGCGACTACTACGGCGCGGCCCCGTCCAACGGACACGCGCGTGGCGGCTCGGCATCGCCCATCACACCCGGT
CTCCCAGCAGAATCGTCGGGGCGGTCTGTGGCGTCAGTCGGAGGCGGTGCTGGCAATGCTGCAGGAAGGCCGAGCACCGG
CCGCAGCTACGAGTCGGCGCCGCGGCCCAGCATTGACTCCAGTCTTCACGGGCACGGGTATCAGCACCAGCACCAACACC
AGCATCAACACCACCAGCACCAGCACCAGCACCAGCACCAGCACCAGCTGCAACAGCTACAGCTGCAACAATTGCAGCAG
CTGCAGCAACAGCAGCAACAGCAGCAGCTGCCACAGAACAGCATGGCTGCCGCATTGCACAGGGTGCGGCGTGACTCGTC
TTCAACGTACAACTCCAATCAATACCCGGCGAGCACTGCGGCCGAGAGCGTCGGCGGTGGTGGCGGTGGTGGTGGCAGTG
TGGCCGGGGCCAGCCGCCGATTTTCAGGGCTGTTCAGCTCAGCCATGCCGATGCAAGACGAGGCGTTGCCGTCGACGACG
ACAGCCTTGGCTGCAGGCATGATGGCAGCCTTCATCGGAGTGGGCGGTTTGGATGGCTCCAGTCGGCCATCACGAGCCTC
ATCACGCGAACGACCGACGGCAAATACAATGTCCGCTTCGTCACACGGCGCTGGTGGCAAGGGCAGTGGCAGGTATCACG
TGCTGTGGCTGGCAGCGTCACTATTCGAATTCAACATTGAGACGAAGCACGAAGCAGGATATCCGTATCTAACGTATCAG
GCGGGAGAGGTATGTCGTGTTTGCTTCTGCTTGCTTATGAATCAGACGATGTATCATCCAGACTGACAAGCATCTCCAGG
TCTTCGATGTCATTGCCGAAAAGGGTGAGCTGTGGCTGGCCAAGAATCAGGACGACCCGAGAGAGCTGGTTGGGTGGATC
TGGTCAAAGCACTTTGCCAAGCTGGCGGATTCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62