GenePrediction:GLEAN_3148 Details

Name: GLEAN_3148
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:478637..479925 (+ strand)
Length: 1289
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:478637..478691 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_161:478752..478793 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_161:478840..479775 (+ strand)
Length: 936
Type: CDS
Source: GLEAN
Position: GCSC_161:479852..479925 (+ strand)
Length: 74
>GLEAN_3148 class=GenePrediction position=GCSC_161:478637..479925 (+ strand)
ATGGCAGACACGACCGAGGTGCTGCAGAACGACCTGCTCCTGCGGGCGGCACGGGGTGAGCAGACTACCGGACTGTCGAC
GATCAATGGCACGGCAACAGACTGACTAGTCGCAGGCGAAAAGGTGGAGCGACCGCCCATCTGGGTGATGCGCCAAGGTA
CGTCTTCCTGCTTGGTGTCTGGCCATTCGAGCTGACGATGCAGCCGGCCGGTACCTGCCCGAGTACCACGTAGCCAAGGG
TGGGCGCGACTTTTTCGAGTGCTGCCGCGACGCCGAGGTGGCCTCGACGCTGACGCTGCAGCCGATCGAGCGGTTTGCCG
GGCTGATCGACGCGGCCATCATCTTCTCCGACATCCTGGTCGTGCCGCAGGCGTTGGGCATGACGGTCGAGATGATCGAC
AAGAAGGGTCCGCACTTCCCAGCGCCGCTAGCCGATCCAGACGACCCCCAGGTGGCGCCGCTGCTAGCGAAGCCGGTGGC
CGCCGCAGCCGACGAGCTCGAATACGTCTACGCGGCCGTCCGGCGAACACGCGAGAAGCTGCACGGCCGCGTCCCGCTGA
TCGGCTTCTGTGGCGCGCCCTGGACCCTCTTCTGCTACATGGTCGAGGGCGGTGGGACCAGGCTGTTCGCCCACAGCAAG
CGCTGGATCTACGCCCACCCGGACACGTCTGGCCAGCTGCTGCACAAGCTCGCCGAGGTCTGCGTCGAACACCTCGCCCG
TCAGGTCCAGGCCGGTGCCCAGCTCGTCCAGGTCTTTGATTCCTGGGCCGGCGAGCTCTCTCCGGCCGCCTTTCGCCGCT
TCGCCCAGCCGGCCCTCGCTCACATCGCCGATGCCCTGCCCCGCCGCCTCCAACAGCTCGGCCTCGCCCCCGTCCCCATG
ATCGTCTTCCCCAAGGGCGCCTGGTACGCGCTCGACGCCTGCTGCCAGCTCGGCTACGATGTCGTCGGCCTCGACTGGCA
GCACGACCCGGCCGAAGCCGTCCGGACCCGCGCCGATCGCCCCGTCGTCCTCCAGGGCAATGCCGACCCCGGTGTCCTCT
ACGGCACCCACGACGCCATCGTCGAGGCTGTCCGCGATATGGTCGTCGGCTTCGACTGGGCTAATCGCCACCAGGGCTGG
ATCGTCAACCTCGGACACGGTGGGTTTTTTTCCTGTTTTTTTTCTTTTGTCTTTCTTTTCTTGTGCTTATCTAATCCGCT
TACTAATCCACTCAGGCATCACTCCCTTTGTCAAGCCCGACGACCTCAAGTTCTTCCTCGAGGAGGTGCACAGACAGACA
AAGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62