GenePrediction:GLEAN_314 Details

Name: GLEAN_314
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:979607..981686 (+ strand)
Length: 2080
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:979607..979620 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_167:979697..979776 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_167:979828..980109 (+ strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_167:980167..980187 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_167:980265..980388 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_167:980454..980536 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_167:980596..980634 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_167:980704..981047 (+ strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_167:981124..981212 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_167:981283..981392 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_167:981458..981576 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_167:981648..981686 (+ strand)
Length: 39
>GLEAN_314 class=GenePrediction position=GCSC_167:979607..981686 (+ strand)
ATGGCGTCCAAGAAGTACGAACCCTATTCCAGTAGCGACCATCGTCGTGATTGGGAGAGCACACGTGCTGACATCCGCTC
TCTTACACAGGGTTCTTATGCTCGGTGCCGGCTTCGTCACGAAGCCGACTCTCGATATTCTCTCCCAGTCGGGTGTCACC
GTGACTGTTGGTATGTGGAGCGATGGGCTGGTGGATGGACCTAGTGACTAACCTATACAAGCCTGCCGAACTCTCGAGTC
TGCCAAGGCTCTCTCGGCCGGCGTCAAGAACGCCGTTCCCATCTCTCTGGATGTGACCGACGAGAAGGCTCTGGATGCAG
AGATTGGCAAGAATGACCTCGTCATCAGCTTGATCCCCTACACCTTCCACGCCTCGGTCATCAAGTCGGCCATTCGCCAG
AAGAAGCATGTCGTCACCACCAGCTACGTCTCGCCGGCCATGAAGGAGCTCGCCGCCGAGGCCAAGGCCGCTGGCATCAC
CGTCATGAACGAGATTGGCCTGGGTAAGATCCTGTCTCGTTATTTTGTGTTGGAGACAATGAGGCTAATTCCATCTGCAG
ACCCCGGTATCGACCACCTCTGTAAGTATCTGGCGCCGAGAGCTTGAAACAAAGCATGCGTCCATAGCAGTACTGACGTT
TGCTTTCTTCTTATCAAGACGCCGTTAAGACGATCGAGGAGGTCCACGCTCAGGGCGGCAAGATTACTTCGTTCCTCTCT
TACTGTGGCGGTCTTCCGGCGCCAGAGAACTCTGGCAACCCGCTGGGCTACAAGTTCTCTTGGTAAGAGACCATTCTCTG
GAATCAGGTCACATAGACAGCATGATTTCGCTTACACTGGCCTCTAGGTCCCCCCGCGGTGTGCTTCTGGCCCTGAGAAA
CGCTGCTAGCTTCTACAAGGATGGCAAGGTTGTGAACATTGCCGGTCCAGGTGCGCATTGTCCCGGCACTGCTCTGCTTA
TTCTGTGAACTGACGTGCTCTCGCCTTAGACCTGATGGCCACCGCCAAGCCGTACCACATCTTCCCTGGTAAGAGGAGCC
GCCAGAGCAGAGGTTTTCGCCTATGCAACTTGCCGTACTGACACTCGACATCTGAAGGTTTCGCCTTTGTTGCGTACCCC
AACCGCGACTCCACCAACTACAAGGACCTCTACAACATCCCGGAGGCCGAGACTGTCATCAGAGGCACTCTGAGATACGC
AGGCTTCCCTGAGTTTGTCAAGGTCCTTGTTGACATTGGCTTCCTCAAGGACGAGGAGCAGAGCTACCTGAAGGAGCCGA
TTGCCTGGAAGGAGGCCACGCAGAAGATCGTTGGCGCCCCATCTTCGGACGAGAAGGACCTCATTGCTACCATTACGTCC
AAGACGATCTTCAAGGATGAGGAGCAGAAGGAGCGCATCCTGGCAGGTCTAAAGTGGATCGGCCTTTTCTCTTCTGAGAG
CGTAAGCTTTTTCTGCCATCCCTCAAATACCTTTTCGTCACAGAATCACTGACATGATCCTTTATGGGGGCCTATAGACC
ATCCCGAGAGGCAACCCTTTGGACACGCTTTGTGCGACGCTTGAGAAGAAGATGCAGTACACCGAGGGCGAGCGCGACCT
TGTCATGTAAGCTGGCACCTGCAGACACTGACAGCCCTGTTCTTCTGTGAGACGCCCTATCTAACAACCACATCAGTCTG
CAGCACAAGTTCGAGGTTGAGCTGAAGGACGGCACCAAGCAGACCCGTACTTCGACATTGTGCGAGTACGGTGACCCGAA
CGGCTACTCGGCCATGGCCAAGCTCGGTGAGTAATCCTTGATCATACTCGAGACTTGGAGAAGTGGAGACTGACAGGACG
ACTTCAATCAGTCGGCATCCCGTGTGCGGTTGCTGTGCAGCAGGTTCTTGATGGCACGCTCTCCGAGAGCGGTGTTCTGG
CTCCGATGAGCAGCAAGATCAACAACCCGCTCATCAAGGTGCTCAAGGAGGTAAGGACAACTACAAATGACTGCATCGTT
CTGTGAGAGGCATACATACTAACTGTCTTTTTCATGTACAGAAGTACGGCATCGAGTGCAAGGAGGAGATCATTGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62