GenePrediction:GLEAN_3153 Details

Name: GLEAN_3153
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:549682..551501 (+ strand)
Length: 1820
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:549682..549783 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_161:549893..549988 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_161:550134..551501 (+ strand)
Length: 1368
>GLEAN_3153 class=GenePrediction position=GCSC_161:549682..551501 (+ strand)
ATGTCCTCCCTTCACAAGAGCCTCCTCCCGTCGCACGCCATTCGGGACGGCGGTGATGGCGAGTACTCCGGCAGACACCA
CGGCAAGACTCAGTCTCACATGGTGCGTTTTCCGTCCTCTGGCCAGATTTCTGGCTCTTGCTCTCGCTTTCACCCCAGCT
CTTCTGCCTGGCCATCTCTCCCCTCTTACTGACAGCTACGACGCCATGCAGGCTTTCGAAAACACCTCCACAAACATTGC
CGCTGCCCAGATGAGAAACTCTCTGACGGCCCTCTCCGAGTCGGTCAGCGACCCGGCAGAGAAGAAGGTGAGCAAGTCTA
GATCCAAGCCCACATCCCTGTAAACCCTCACCGCCGGACGATGCTCAGATTCGTCCCGCACAAGTCTCCCCGCTCAGGGG
TTGTGGCGCACACCGCTGACCCCCCATTTCCTCCCACCCTCCCCTGTATCAGCTCTTCGAGACGGAAATGGACAACTTCT
TTGCCCTCTTTCGCCGCTACCTCAACGACAAGGCCAAGAGCAATGCCGTCGACTGGGACCGCATCCGTCCGCCTGCCCAG
GGCCAGGTCGTCGACTACGAGCAGCTCGGCAGCACCGAGGGCGTCAGCTTCCTCAACAAGCTCGCCGTGCTGAAGCTCAA
CGGTGGTCTCGGTACCTCCATGGGCTGCGTCGGCCCCAAGTCGGTCATCGAAGTCCGTGATGGCATGTCCTTCCTGGACC
TGTCCGTCCGCCAGGTCGAGTACCTCAACCGTACCTATGGTTGCAATGTGCCCTTCATCTTGATGAACTCGTTCAACACC
GACGCCGACACTGCTTCCATCATTAAGAAGTATGAGGGACACAACGTCGATATCCTTACCTTCAACCAGTCCCGCTATCC
CCGCATCCTCAAGGACTCGCTCCTGCCTGTCCCCAAGTCCTACGCCGACTCCAACGAGGCCTGGTACCCACCCGGCCACG
GTGACGTCTTCGAGTCACTCTACAACTCGGGCGTGCTTGACAAGCTGATTGACCGCGGCATCGAGATCGTCTTCCTGTCC
AACGTCGACAACCTGGGCGCCGTCGTCGACCTGCGCATCCTCGAGCACATGGTCGAGACCAAGGCCGAGTACATCATGGA
GCTGACCAACAAGACCAAGGCCGACGTCAAGGGTGGCACCATCATCGACTACGACGGCTCCGTCCGCCTGCTCGAGATCG
CCCAGGTCCCCAAGGAACACGTCAACGAGTTCAAGTCTATCAAGAAGTTCCGCTACTTCAACACCAACAACATCTGGATG
AACCTGCAGGCCGTCAAGCGCGTTGTCGAGAACAACGAGCTGGCCATGGAGATCATCCCCAACGGCAAGACCATCCCCGG
CGACAAGAAGGGTGAGTCCGACATCTCCATTGTCCAGCTCGAGACGGCCGTCGGCGCCGCCATCCGCCACTTCAACAACG
CCCACGGTGTCAACGTGCCGCGTCGCCGCTTCCTACCCGTCAAGACCTGCTCCGACCTGATGCTCGTCAAGTCTGACCTC
TACACCGTTAAGCACGGCCAGCTGCAAATGAGCGCTAACCGCTTTGGTGATGCCCCGCTCATCAAGCTCGGCAGCGACTT
CAAGAAGGTGTCCGACTTCCAGAAGCGCATCCCCTCCATCCCCAGGATCATCGAGCTTGATCACCTGACCATCACCGGTG
CCGTCAACCTTGGCCGCGGGGTCACGCTCAAGGGTACCGTCATCATCGTCGCCACTGAGGGCAGCACCATCGACGTCCCG
CCTGGTTCCATTCTGGAGAACGTTGTGGTCCAGGGTAGCCTGCGGCTGCTGGAGCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62