GenePrediction:GLEAN_3155 Details

Name: GLEAN_3155
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:560160..562423 (+ strand)
Length: 2264
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:560160..560179 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_161:560283..560307 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_161:560457..560468 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_161:560534..560936 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_161:560993..562323 (+ strand)
Length: 1331
Type: CDS
Source: GLEAN
Position: GCSC_161:562388..562423 (+ strand)
Length: 36
>GLEAN_3155 class=GenePrediction position=GCSC_161:560160..562423 (+ strand)
ATGGCTGACAAACTTACACGGTAAGAAGCCGCCTTCTTGACCAAGCAACCGGTTTATGTCTTTAGCAGAAACGGCTATAC
ACATGGGAGAATACCAAAGACCTAGATGCTGACCCTCCAACAGTATAGCCATTGTCAGCAGTGACAAGGTTCGTCTACGA
AACATCCCTCTTCTGCTCACCTTGCCCGACGTTAAACCCGATATCATGATCACAAAACGCTCGAGCACGGTCGTTGGGAT
GATGGGGGTGCAATCAAGTATAATGTGACATGTGCTGACATGACTCCTGCTCCATAGTGCAAGCCGAAGGTATGTGCAAG
GTGTACCTGTCTGCTCTGCCTGTTCTAGGAGGAAGTCGCTGACGTGCTTTCCAGAAATGTCGGCAAGAATGCAAAAAGTC
CTGCCCGGTTGTCCGCAGTGGAAAGCTGTGTATCGAAGTGGCGTCGGACTCCAGAATCGCCTTCCTGTCTGAGAGCCTGT
GCATTGGATGTGGTATCTGCCCGAAGAAGTGCCCTTTCGGCGCCATCACGATCATCAACCTGCCGACCAATCTCGATACC
CAGCTGACCCACCGCTACTCTGCAAACAGCTTCAAGCTGCACCGTCTGCCTATGCCGCGCCCCGGCCAGGTCTTGGGTCT
CGTGGGAACAAACGGTATCGGCAAGAGCACGGCGCTGAAGATTCTGAGTGGCAAGCTCAAGCCCAACTTGGGTCGTTTCG
ACAACCCGCCGGACTGGGAGGATGTCATCAAACATTTCCGTGGCTCTGAGCTTCAGAGTATGTTTGCCTGCGTTCCTGTC
AACGGCGAGACGAAATGCTGACTCAGCAAATAGACTACTTCACGAAGCTGCTCGAGGACGACCTCAAGGCGGTCGTCAAG
CCGCAGTACGTCGACCAGATCCCCAAGGCCATCCGCGGCCCCATCAAGTCGGTGCAGAAGCTCATCGAGAGCCGGGCCAC
GATGGACAACCTGGATGACGTGCTCGACGTGCTGGAGCTGCGCCACATCTACGACCGTGACGTGACGCTCCTCTCGGGTG
GTGAGCTGCAGCGCTTCGCCATCGGCACCGTGTGCGTGCAGAAGGCGGATGTGTACATGTTTGACGAACCGTCGTCGTAC
CTGGATGTGAAGCAGCGTCTGGCAGCGGCGCGCATGATCCGGTCTCTGGTGCGATCCGACGACTACGTGATTGTGGTGGA
GCACGATCTGTCGGTGCTCGACTACCTGTCCGACTACATCTGCGTGTTGTACGGACAGCCGGCGGTGTATGGCGTTGTGA
CACTGCCGTATTCGGTGCGCGAGGGTATCAACATCTTCTTGGACGGCCACATCCCGACGGAGAACCTGCGGTTCCGGCAG
GAGTCGTTGACGTTTAAGCTGTCGGAGGGTGCGGACGACTTCATCGCCGACCGCTCACGGGCCTTCCACTACCCCAAGAT
GGAGAAGACGATGGGCAACTTCAAGCTGGACATTGATTCGGGCGATTTTACCGACTCGGAGATCCTGGTGCTGATGGGCG
AGAACGGCACGGGCAAGACGACGTTCTGCCGACTGCTGGCGGGTGCCCTCAAACCAGATGGCACGCGGCGTGTGCCGGAG
ATGAAGATCAGCATGAAGCCGCAGACGATCACGCCCAAGTTCGACGGCACGGTGCGTCAACTCTTCTTCAAGAAGATCCG
GCCGGCTTTTTTGTCGCCGCAGTTCCAGACGGACGTGGTCAAGCCGCTCAAGTTGGACGACTTTATCGACCAAGAGGTCA
AGAACCTGTCGGGTGGTGAGCTGCAGCGTGTGGCCATTGTGTTGGCGCTGGGCCTTCCGGCCGACATCTACCTGATCGAC
GAGCCATCGGCGTACCTGGACTCGGAGCAGCGCATCATCTGCGCGCGCGTGATCAAGCGCTTCATCATGCACGCGAAGAA
GACGGCCTTTATCGTCGAGCACGACTTTATCATGGCCACGTACCTGGCCGACCGCGTGATCGTGTTTGACGGCCAGCCGG
GCATCCACTCGCACGCCAACGAGCCCGAGTCGCTGCTGACGGGCTGCAACACCTTCCTCAAGAACCTCGACGTGAGCTTC
CGTCGCGACCCGGTCAACTACCGTCCTCGCATCAACAAGGCCAACTCGCAGCTGGACCAGGAGCAGAAGGCTGCTGGCAA
CTACGTATGTGGGATCTTGTTTTGTTTTTTGTTTTATGTTGCTTGTCGATATCGACTAACACGTCCAGTTCTTCCTCGAG
GAGGATAACAGCAAGGCGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62