GenePrediction:GLEAN_3156 Details

Name: GLEAN_3156
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:566784..569171 (+ strand)
Length: 2388
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:566784..567309 (+ strand)
Length: 526
Type: CDS
Source: GLEAN
Position: GCSC_161:567369..567839 (+ strand)
Length: 471
Type: CDS
Source: GLEAN
Position: GCSC_161:568585..569171 (+ strand)
Length: 587
>GLEAN_3156 class=GenePrediction position=GCSC_161:566784..569171 (+ strand)
ATGGACCACGACCGCAGCATCGGGAGCGTCTCGCCGCACCGATCAGTGGCCGGATCGAGAGGTCAAAGTCCTACAACTCC
GTACTGCGGAGTATGCTACTTTCGCTTGCCCCCGGGTGCCCTTTCCTTCGAGACGCACGATGGCGGGGCGTTTGCGCCGG
AGGAGCCGGAGTCTTTCTATCATTCGACACCGCGCGACCGCAGTGAACCCTTTATAGATGGGACTAGGAGCTTTTATAAG
TCTGAATATTATAGAACCAATTGGTTCGCCTTATCAGCGGGTTGTGGCTGTACCACCTGTGCTGCCCTGCGCGACGTCCT
TGCCGAGCAACACCCATCGCTATTCGCTAGTAGGAGCGGTAGTAAAACGAAGGACCAAAGCAACTACGAACCTGTATATT
ATTGGCTCTTTGACTCGGTTAATAGTGCTACGCGGCTGCGTATATTGAACAGTATTACAACAATTACATACCACCTTCTC
TTTACGCCCGCTACTAAGTACGCCAAGTCGTTGCCGTTGCCTACAGGTAAGTTAGCATTGCTGCATAGGAGTGATCGTTC
ATTGATGACATTTTCTTCTGTACAGAGTCCGCACAAGTTATCCCTTTCAGAGACTTTCCTTCCTATGATACGGCCAGCGA
TACCGCTCTTTCTCGAGTCAAAACGTGGCTAGCCGAATGCACAGCAAATCATACGCCGTGCGGTGATGGCGGCGAGCCGT
CTATACTGCCACGACGGGTTCTACGTATTACCGACGACGACGAAACAGGGATCATGCTGAAGCTGGTCGACGGGGCGGGC
CTCAAGGAGCCGTATGCGTGCCTAAGTTACCGTTGGGTCACAAAGACGCAGTCGCTGCAGCTTGGGAAAGACACCGAAAA
ACAGTTCCGGGAAGGCATCACTAAGGAACAGCTGCCTCGACTATTTACGGACGTACGCAACGTCGTGCGCCGTCTGGGTT
TGCGCTACCTGTGGATCGACAGCCTATGCATCCGGCAGGACGACTTACACGACTGGCGCACCGAGGCTGCTGCTATGGCT
TCCATCTATAGCGGCCGTCAGTAACGGCTGCGATGACAGCCTCTTCCGGACGTACGACCCAGGCCGAACTCACGAACCCG
TGGCCACTACTGCGGATGGCAGTCCCGTGTACATAATGCGGGAACTGGCGCATCCTTCTGACTACGATGAAGATTTTGTT
GCCTTGCCTTTGCTGGAACGGGGCTGAGCGTTCCAAGAGAGACTGCTGTCGCGACGTGTTGTCTACTTTTCTGAAAACGA
GGTGACTTGGAACTGCTGTGCAGCTGAGAGATGCGAATGCCGCGGCTTTGAGGAAGAAAGTCCAACTGATAAAAGAACGC
CTCGGCTTTTCAACAACACAGATTGGCTTTTATGTGTCAACTCGTATACACGTCTAAGCTTGACTGAATCTTCTGATAAA
CTGCCAGCGTTAGCCGGTATTGCTAAGATGCTGAAGAGCCAACCGGATGACCCGTTACAGCCTCCACTACTTTGGGACCC
CTCTTTGAATGGCTGTAAGTACAAGTTTATTGTATGCATCTGTTGCCCTGGCACAGCAGCACAGCAGCGTCGTCTTGTGG
CTGACTGCATCTATCAACGTCAACCCTACTTAGCTAGAGGGTCTGAACCTAAATGTTTACGCGGGCCTTACCTAGCCAGC
CTCTGGGCCAGCGATATCTATGGGGGCCTACAATGGTATAGTATGGTTGCCGAATTCTTACTTCCAAGACCGGAGCCGCT
GTTGGCCCCAACCTGGTCTTGGGCCTCAACGTTTTTACCAGTTTGGACCGCCTCGGAACAAGCTTGCTATCCGGTCACGG
TGCAGAAGTGGGACATGGAGTTTCTTGGCCCGGACGACTTTGGCCACGTAAAACACGGACGTTTAACGGTCACAGCGCAC
GTCTTTTCCGCCACTATCCATTACGGAAAGGAGGATTACGAAGCCTGTGACGAGGCACCTCTACATCCTAACTTCCGGCG
AGAGGACGGTACCAGCGATACCGTTAGCTCAAGCAGATTTGTCCCACCGCCTCTGTCGCATAACGGCCAAAACTGTCTAA
TAACCAAGTATGAATTTATGTTGGTGGTAGATGGCTACGCCTTCAAGTGGACCCCCGACTACACACTGCAGATGCCGGGC
GATGGTTATGTGGCATCGGGCACACCGGTGCGCTGTCTCATCCTAAGCAGAAAATTTGTGCTTGTCGCACGCTGCGTGGA
TGTGGCTCAGGGCTACTACGAGCGACTAGGTTGCTATCTCAAGGAGAACGGCTTCAGATGGAAGAAGGGCCATGGGTTTT
CTCTAAGTGATAATATGACGACTGAGTGGATAAAGAATTCGGTCATGGAGGGCACTGTACTCGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62