GenePrediction:GLEAN_3157 Details

Name: GLEAN_3157
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:572344..573357 (+ strand)
Length: 1014
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:572344..572375 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_161:572427..572533 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_161:572681..573027 (+ strand)
Length: 347
Type: CDS
Source: GLEAN
Position: GCSC_161:573310..573357 (+ strand)
Length: 48
>GLEAN_3157 class=GenePrediction position=GCSC_161:572344..573357 (+ strand)
ATGTCGCCTAGAGGCGAGGAGGTCGAGAAGCGGTAGAGGCCGGGCTGGTGCCACTGGTCTCCGTGGATGTGGTATTCTGG
AAGTCGGATTCTCTCATCGAGCATCCTGGAGTATGTCAGCATGGGCATCAAGGCAAAATGGCACGCAGAACTGCCGATGG
TGGAGAAGCGAGGCCTTACAGGTGGTCCCGGTTTGTGTCCATGATCATGCCCGAGGCGAAGTGACGGCTTCCGAGTCTGT
AGTGGAACCAGTCCTTCCTCGACTGTGCCTGGAGATATGGCTCGGCCGGATGGGCATCCGGATCGGGGGCGGCGCATATG
CTGGGCTGGTCGTCTAGGTGGTGCTCTCGTCTCGAGCGAGCCCGGCCAGGTCGGTATGTCTGGACTGCGGAAGAGGGGCA
AAAAAGCGCGGGGCAAAGTCGCAGGCGACATCCTCGTCCGCATCGAGATCGTCGAGGACGTCGACGGACATTGCCTGCAG
CTGTGCGCTGCTGACGGTGGCAATCTTGACGGCACACAGCTTGTCAATGAGCTCACAGATGGAGTAAAAGTATTAGGTGT
GGGCGGCGCGCCGCGCGTCGGCCAGAGAGCATTCGAATTGGCTCCATTGCGGATAAAGAAAGATGAAGCAGCTCTGTTCC
AGGGTTGGACAGGGAGAGAAAAGGAAAGCTCGCGGAGACCGGAGGTATGGGACTTTTTTTCATGTGGACAGACAGGCTGT
GTGGTAGTGTTCGTGGAAGGAGTATTGCCAATTCAACATGTCTGCGGTCGTTGTAGACAGCGGTTCACTTGTCGTGGCGG
CATTGTTCTGTTTCCACGTCAACTACCATCCGATGCCGATTACATAATCCATTGCAATGCAATACATCACGTGCAAGGCC
CCGGCCTCGAGAAACGGCCGCCGACACGTTGTGTATCTTACGACGTATGGAGTACATTGCTATTCTTTCTGGCTAATGCA
TCACAGTATACTATTATTATCCTGGTCGTCGAGAACGCGGTCGACCAAGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62