GenePrediction:GLEAN_3158 Details

Name: GLEAN_3158
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:574183..575446 (+ strand)
Length: 1264
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:574183..574641 (+ strand)
Length: 459
Type: CDS
Source: GLEAN
Position: GCSC_161:574696..574973 (+ strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_161:575038..575446 (+ strand)
Length: 409
>GLEAN_3158 class=GenePrediction position=GCSC_161:574183..575446 (+ strand)
ATGACATTCACAGAGTTCCTTCACCTGAAGGTTCTCTGGACAAGAGGTGACATCAACGACTTGTTCCCTCAGGAAAATGA
GCCGGATTTCTTTTCTCGCTCCGCCCTGCAGTGCGTTCACAAGGACTCTTTCAGAAATATCGAGAGCGACCTCGAGGCTA
CCAAAGGTCGCGATCCGCATGCTCTGATCCACAGCGGCAAGATGGCGGCGGGACTGTTCAGTGTGTTCGAAGCATACATT
CCTCTCATCATGTCGATAGACGCACAGCCGGGCGTGGATTCGTCGCCCAAGGTGATAAACCTGGGCATTGTCCAGCCGCA
GCCGAAAGCATCTGACACGTCGGGCATGGCGAGGCAGCTTAACAGAATGACGCTGCAAAAAACGCCCATGTCGTCTTTCG
GGAGCCCCCTGACGCCGGAAACTCCGGAATTGTCCCTTCGGGCAGAATATGAGGCTCTGGTAAGCTTCTCTTTAATTGAA
CTGCTGAATGCGGTGAGAATCCAGACGAAACAGCTCGACCACGCCACTTGGGTGCCCGACCCCAAGGTATTTGTTCTGAA
TGACAAGAAGAACTCGAGGCGTCTTCTCGAGGCTCGGGTGGACGGCTATCTGCGAAAGAGGATGGGTGCAAGCGCGTACG
GGATTGTGGAAGTCAAGCCGTACGTGCGCACCTCGCACACAGACCAGATCGAATGGCAGGAAGGCGCTCAGATGGCGGCT
TGGATCTCACAGACTCCGGGCACCGTCAACAATGGCGTCTTTATGGCTCCGGGAGGTGCGGGTATCATGCGGTATGTTTT
TTGTGATTGTCTTTGCTGGTCCTTGCAGAAACCGGCTGACGAATGGTCCTCGCAGACGATTTATGATTACACAGAACCGA
CAGGAGATCTACGTCACAGTCGCCGAGTACGACAAGACGTACGAAGAATATCTCCACGGCGGACCTCAGACGCCGCCGCT
CCCATCCAAAGGCCCGGCTCCGAGAGCGCCGATGCAGATAGGCAAACCGCCGCAGGCTGTGCCCCTGGCACCACGCAAGG
GAGCTCGGGCAGAGTACTACGGTGGCGGATACGACGGCAGTGTGAATCGGCCGTCCGGCTACGGCCAAGGACAGTCTTCG
AAACAGCCACTGGTGGATCCAACGCCTGGATTCCTTCTTATGCGCTGCTTCGGGCCTGTCCCGATCAACGACCCGAGGAG
GATGCGCAAGCTGTGCCAGGCTATAGTTGCGCTCAGCATTGAGGCAGTCGGTGCTTGTTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62