GenePrediction:GLEAN_315 Details

Name: GLEAN_315
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:983253..987257 (+ strand)
Length: 4005
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:983253..983666 (+ strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_167:983766..984343 (+ strand)
Length: 578
Type: CDS
Source: GLEAN
Position: GCSC_167:984455..987257 (+ strand)
Length: 2803
>GLEAN_315 class=GenePrediction position=GCSC_167:983253..987257 (+ strand)
ATGAATTTGAATCCGGGCATTCAGATCTCGATCGATCGTGGCGGCACGTTTACCGACATCCACGCCTCAGTGCCGGGCCG
CGACGATATCGTGCTCAAGGTGCTCTCGGTCGACCCGGCCAACTACAGCGATGCGCCGACAGAGGGCGTGCGGCGGGTGT
TGGAGCTGGTGACGGGACGGCCGCACCCACGCGGCCAGCCGCTGGACACGTCGCCAATTGCGCGCATCCGCATGGGCACG
ACGGTGGGCACCAACGCGCTGCTGGAGCGCAAGGGCGCGCGCTCGGCCCTGCTGATCACCAAGGGCTTCCGGGACCTGCT
GCACATTGGCAACCAGGCGCGGCCCGACATCTTTGACCTGACCGTGGCCCGGCCTGAGCTGCTGTACCAGTCGGTGGTCG
AGGTGGACGAGCGGGTCACTCTGGAGGCCTGGTCGGAGAATCCTGCTGGTGATTCTGCTTCTGCTGCTGCTTCTGCTAGC
GATGCTGACCTTCACATCGGCCTCACCGGCGAGCTTGTCCGCGTGCTCCGGACGCCCGACCTGGAGGCCGTGCGTGCATC
GCTCGAGCAGCTCTGGCTCCAGGGCTTCCGCTCGCTCTCCGTCGTGCTGCTGCACTCGTACCTCTACCCGCTGCACGAAC
AGCAACTCGGCGCGCTCGCCCGCGAGATGGGCTTCTCCGTGGTCGAGTCAGCTGCCGTACAACCGATGATGAAGGTCGTG
CCGCGCGGCATGTCGGCCACCGTCGACGCTTACCTCACGCCCATCGTGCGCGCCTACATCGACTCCATCTCGGCCAATTT
TCAGGGCGGTCTCGCGGCCGAGGGCCTGCGCTGCGAGTTCATGCAGTCCGACGGCGGCCTCGTCGACTTTCGTCGCTTTG
GCGGTCTTGCCAGCATCCTCTCCGGCCCGGCCGGCGGCGTCGTCGGCTATGCCCAGACATCCTGGGATGCTGATGCCCGC
AAGCCCATCATCGGCTTCGACATGGGCGGTACATCCACCGACTGCTCTCGCTTTGCCGGCACCTACGAGCACGTCTTTGA
GACCACGACAGCCGGCATTTCGATCCAGTCGCCGCAGCTGGACATAATCACGTGAGTTTGCGTCGCCCCTTCCTCTTTTG
TCATTTCCTCTTGCTTCTCTTTCTCTCTTGACATCTCGTTTCTGCTCCCTCTTTCTTGCTTTCTCATATCCTAACAATAC
AGGGTCGCTGCTGGTGGTGGTTCCATGCTCTTCTGGCGCAACGGCCTCTTTGCCGTAGGCCCTGAATCTGCCGGGGCACA
CCCTGGTCCCGCATGCTACCGCAAGGGTGGCCCGCTCACGATCACCGACGCAAATCTCTTTCTCGGCCGCATCGCCCCCG
AATACTTTCCCAAGATCTTCGGCCCCAACGAGGACCAGCCGCTGGGCACCGAGATCGTGGCTGCCAAGTTTGCGGAGCTG
ACGGAGCAGATCAATGCCGACAACCGTGCTGCCGGCCGTGCATCCTTCACGTCCGAGGAGGTGGCGCTCGGGTTTCTCCG
CGTGGCTGCACAAGTCATGGCACGGCCGATTCGGGCTCTGACGGAAGCCCGCGGCTTCGACACTTCCGACCACATGCTCT
CGTGCTTTGGTGGTGCTGGCGGACAGCACGCCTGCGATGTGGCCAAGGCCCTGTCCGTCACCGAGGTGGTCATTCACAAG
TACTCGTCGATCCTGTCGGCCTATGGGCTCTCGCTTGCCGATCTCGTGCACGAGGAGCAGAAGCCGGCGGCGATCTCGTT
TGAGGCAGCCAACCTGGCTGTGATTGGCAGCACGCTGGCCGAGCTGTCGGACGCGGCCATGGCACACCTGGTCAGCCAGG
GCATCAATGCGTCGCAGATCCGTCTGGAGCGCTACCTCAACATGCGCTACGAGGGCGTCACGGCGGCCACGATGATTCTA
CAGGACGGAGAACACCAGGACGGCATCGAGTCGTTCCGAAAGCTGTTCGAAGAGCGCCATCTGCGCGAGTTTGGCTTCGT
CTTTCCCGAGAAGCGCATCCTCGTCGACGACTACCGCGTGCGGGCAGTCGGCGTAGCCGCAAAGCACACAGAGAAGAGTC
CGTTCCAGCAGGCAAAGGAGGCTCGTGCACGGCCGCCGGTGCAAGCAGCCAAGGCCGCAGCCACAGCTCTGGTCTGTTTC
GATGACGGCACAGCCGGACAGCGGGTTCCGACGAATCTGTACCTGCTCGACCAGCTGCAGGCCGGCACGCACATTGCCGG
TCCAGCCCTGATCCTAGACAAGACGCAGACCATCTTGGTGGTGCCAGGAGCCACTGCGCTCATCCTCGATAGCACAGTTA
TGATCGACCTGGCTAGCTCCACCGCGGCAGCGACAGCGACACCAGGGGCAGCAGCAGACAAGAGCGTGAACCCGATCCAA
CTCTCCATCATGGGGCACCGGTTCATGTCGATTGCAGAGCAGATGGGCCGCACGCTGCAAAAGACAGCGGTATCGACCAA
CATCAAGGAGCGACTGGACTTCTCGTGTGCCATCTTCTCGCCGGACGGTGGGCTGGTATGCAATGCGCCACACGTGCCAG
TGCACCTCGGAAGCATGCAATTCTGCGTGCGGCATCTACACACGGCGTGGGCCGGCCGTCTAGAGGACGGCGACGTGCTG
GTGGCCAACCATCCAACCAGCGGCGGGACGCATCTGCCAGACATCACGGTGGTGACACCTGTGTTTGACCAGGGCGAGAT
TGTGTTCTACGTGGCCTCCCGCGGCCACCACGCAGACATTGGCGGGACACGACCTGGGTCCATGCCGCCGGACTCGCACT
GGCTGTACGAGGAGGGTGCGGCGATCTTTGGCGAGAAGCTGGTGAGCCGCGGACGATTCAACGAGGCCCGCATGGTGGAG
CTGCTGCTGAAGGAGCCGGCGCAGCAACCGGGCAGCTCGGGCACGCGCAAGCTGAGCGACAACCTGTCAGACCTCAAGGC
ACAGGTAGCGGCCAACAAACAGGGCATCCACCTGATTCACGCGCTGATCCAGGAGAACGGGCTGGCAGATGTGCATCGCT
ACATGTATGCGATCCAGGACAATGCCGAGGAGGCGGTGCGGGCGCTGCTCAAGAAGATGCACGCATCAGTGGCGGGCGAG
CCGCTGCGCGCAGTCGACTACATGGACGATGGGACGCCGATCGTGCTGACGGTGACGATTGACGAAGCGACGGGCAGCGC
GGTGTTTGACTTTACAGGCACGGGGCCGCAGGTGTACGGCAACACGAACGCGCCGATCGCGATCACGCACTCGGCCATCA
TCTACTGCGTGCGGGCGCTGTTGGCGTCAGATGTGCCGCTCAACCAGGGCTGTCTCAACCCGATCGACATCCGGGTGCCG
GCCATGTCGATTCTGGCGCCGTCGCCGTCGGCTTCGGTGGTGGGCGGCAACGTGCTGACGTCGCAGCGCATCACGGACGT
GATCCTGGCGGCTTTTGGGGCCTGCGCCGACAGCCAGGGCTGCATGAACAACCTGACCTTTGGCATGGGTGGCCGACGGG
TGGCGGCCGACGGCAGCGCGACAGTGGAAGCGGGCTTTGGCTACTACGAGACGATCGGCGGCGGAGCCGGAGCCGGGCCG
ACGTGGGACGGCACCAGCGGTGTGCACACGCACATGACCAACACACGCATCACGGATCCGGAGGTGCTGGAGAAGCGCTA
TCCGGTGCTGCTTCACAGCTTCAGTCTGCGACCAGGCTCTGGTGGTGCCGGGCTGCATCGTGGCGGCGACGGCATGGTGC
GCGACCTGGAGTTCCGTATTCCCGGCATCCAGGTATCGATCCTGTCGGAGCGGCGGACACGGGCGCCTCGTGGTCGAGCC
GGCGGCAGCGACGGCGCAATGGGCCGCAATCTCTGGCTGCGCAAGAAGGACGGGCTGGCCATCAGCCTTGGCGGCAAGGC
GTCGGCGCTGTTCGAGGCGGGCGACCGGATCGTGCTGCACACGCCCGGTGGCGGTGGCTGGGGCAAAGCCGAGGAGGAGG
CATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62