GenePrediction:GLEAN_3160 Details

Name: GLEAN_3160
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:590662..594849 (+ strand)
Length: 4188
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:590662..591351 (+ strand)
Length: 690
Type: CDS
Source: GLEAN
Position: GCSC_161:591400..592521 (+ strand)
Length: 1122
Type: CDS
Source: GLEAN
Position: GCSC_161:593393..594114 (+ strand)
Length: 722
Type: CDS
Source: GLEAN
Position: GCSC_161:594162..594849 (+ strand)
Length: 688
>GLEAN_3160 class=GenePrediction position=GCSC_161:590662..594849 (+ strand)
ATGGATTTCCTCTACTTTGTCTTCGGGATAGCACGACGCGTCGCGCCCAACGGGACACATCGCAAATTGATCCTCGATAC
CGAAAACACCATGAGTCAGGTAGAGTCGAACGATGATATTGATCTCCCCAAGACGATAGAAGAAGCATGTCGTCTTCTCA
GGAGACGCTTCAATAATATCAAAGTGCAACCAATCTCGGATGGAACCCGTGACTTTTTTCCGGAGGGAAGTATAGAAAAC
CTAGTGTCCCGGTCTATTATGAGGAACATCTTATCAGGTTCGCCCGAATCCTTGGTCGACTACGTCTGCGAGAAGGCTCC
TTTTGCCTTTTCACATTTTGTTCCCCGAGGCTTTCATGGCCATTCGCTGTCGGAACTTGCACAGCTGCTTGAACAAGTCG
GATACAACGACACTCTGCTCCCTCTCGTGAAAGCCGATCCAAGAATCAAGTGGCAAATCTCGGGTCACCCAGATTGCGGA
AAGTTAGAGGATCTGAAGATGGACCTCGATGACTTTAGTTTGGGTCCGCAGTGGGAACGTATTCCAGTGAGCTTCGAACA
CATCAAACTGGAATGCTTCGATGATCAGCGCCGCATGCCGTTTGTGTCCTGCGAGGAGAAGGGTAAAGAGACCTACTACA
GTGCAATGCTGGAATGCCGAGTTCACAAAAAGCATCTCAAAACTACTGTGGTAGGATGTTCGGCCGATCTTTGTACTTAA
CAAGCGCTAACAATCCAGGGGGTGCCTACCGACGCAAAAGGACACTTCCATGTTGCCGTTAAGAGGCTGAGATCGATGGA
TGAAGAAGCCGACGGGAAAGCTATAATCGAAGAGGAAGTGAAGGCCTTGAAGCTGGCTAGGGGTCTCGAGACGGAGCACA
TCATCAAATTCATCGCCCATTATAAATGGAAGGGCAAGCATTTTCTTATGTTTCCCTGGGCCGGTCGGGGCGATCTAAGA
GAGCTTTGGGAAAAAAACAATACCCCACCTGCTCTGAGCAAGGATGTTATGCTCTGGATGATGGGACAGTTTTCTGGTAT
GGCCGGCGCCATTGAGGAATTGCATAACAGATCTGGCGAGGATCGACAAAATTATTGCCGCCACGGCGACATCAAGCCAC
AGAATATCCTGTGTTTCGGCAAACCCGACGATCTACTCACCCAGCTCCGTCTTGTCATTGCAGACGTCGGCATAGCCCGG
ATTCATGAGAAAGTCACAAAAGACCGATCTCGCACGAAGCCCTCAGCATCGACAATCATGTACGAAGCCCCCGAGATGGG
AGTGGGCAGTTCGACTGAGCCCAAGTCGCGGGACATAGATGTATGGTCAATGGGTTGCGTTTTTCTCGAATTTATTGTGT
GGCTGCTCTATGGCTACTCGGAACTCGACCTCTTCAGTAACGATCATGGGGATAAGTTCTATAAGATTGAGAAAGACGAA
ACTGGAAACACAGCAGTTTTGCACCCGGGCGTACGTCATTGGATCAAACACATTCAGGACAATGACTGGCGATGTGCCAA
GGGGACGCCCCTGCGGTCATTGGTTGATCTCATTGCTACGCGACTGCTGGCGGTGGCCATTAGGGAACATCCTGGAACAC
CCCCTGACGATGAAGTTAGTCTCGCGAACGGTGTAAGCGGTATACAACTTTTCGTGAGGGCAGCCACGGTATATGACGAT
GCACTGGACAACAACAGGATCGTGCGAATGACATCAACGGAACTAAAAGAGCGTTTACAGACCATCAGGGATACTGTAGA
AGCTTCAGATGTTTACGATTGCCATCCAAAGGATGTGCCGCTAGCACCCAGGAGCTACGTTCGTCAAAATCTAGATGTTC
CCAGCGAAGGGGACAAGCAAGTGCGTGTTCCCAAGCTTTAGCTTAAGCCTAGCTGACAACCAAGCTGCTTATCAATGGTT
TCTTTGTTGGTGTACAATAGCTAACAACATCCAAGGTTGGAAACGAAGTAGGTAGATAGTAACGTTGATCGATCGAAACC
AGCACTAACACGCTCCTTTTCGATAGTATGTAAGTTAATGGCTTGCTTATTAGGCTATAAAATCACGGCTAATTATCACA
GAGAGTGAGTATCCCTCTTTTTCTTGGAAGGGGGGTTTCTAATAAATTTAGTTTGTAAGTAATGATCGAAACCCCGAATA
ATGTTGTTACTAATATGTTCCAGACGGTCAGTTAGTTGAATCAAGGACATGCTATTCGGAGCATCAAACTGACATGTCTA
GCCGGTATGTCGTTCCCCTGTCTATATTACGACTAGCCTTCTGCTAATGTTACTAGTTGGATGACCGGTGGGAATACACA
CCGGACACAAATTTGGCCATGGAACTTTCTCACACCCCCGATTCTAACGAACTCTTTCCTGCATCTCTTTCCGCCAAATC
TTCTCAACTTTGTGCTCGTTGCAGTAGCTTAAGTCTGCTCGAATTAAGCCGTGAAATACCAGACACATGCACCGACCTTC
AAAGACGATCAAAAGAGGATAATTGCACCCTCTGTAGTCTACTTGCGTTTCAAATACAGGGTCGCGTGAAAAACACTCGC
GATGTTGTAAAAATTATCCAGATTGGTACCTTTTTGACCATCCGAAACCAGACGCCAGTTGCGATTATCTACTCCACCCC
AGGTGCATACCCTTAATGTTCTTTCTGTCTTTCTTCACTCCCCCTCTCCTGCTAACTAGCAGATTTCCATCCAATCTACC
CTAAACTTCAGGTAGGCATCCCGAAACTGCCGGAGGCTGGGAGCCTAGCACACCTTCGCATTCTCAAGGCGTGGATTGAA
GACTGTGATGAAACACATCAATGCGTCCCAAAAGGAATAGATTTCCTGCCGACAAGACTATTAGAGGTCACAGATGACGG
TTTTATACGACTTGTGCATACCGTCCCCGATCAAGCCAAAAAGAAACGTTATGTCGCTTTTTCCCACCGTTGGGGAAAGT
CTACGTGGGAGCCACAGTTCCGCGTGTACAATACCAACATTAGTCAATGGCAAAATGGTGTTCATAAGGCCCAGCTACCT
CAAAGCTTCCGGGACGCCGTACGCATCACGCGTGGCCTCGACATGCGTTATCTCTGGATCGACTCGCTCTGTATAATTCA
GGATAACACCGAGGACAAGATAAGAGAATTGCAACGGATGGAACACGTCTTCAGCTCGGCATACGTGACGATAGCGGCCA
CCTGTGCCACTGACAGCAACGACAGATTTCTCAAGACGCGCTATAAGCGCCGCTATGTGTCTATGGGGAGGTACACCGTC
TGCGAGCCCATTGATGACTTCAGCAAAGACGTCGACCAGGCCAGTATCAATCGGCGCGGTTGGGTGCTACAAGAGCGCGC
GCTATCGCGGCGGACCATTCACTTTACAAGCAGACAAACATACTGGGAATGCGGTGGCGGCGTGCGCTGTGAGACGATGA
CGCGGATGAAAAAGTACTTTCTCTTCCGTCCTTCCTCTATTCACAATTACTGACCAACAGCCCTAAAGCGTCCATCCTAA
GTGACCCCAACTTCCCACAGTCACTAAGCGCTTTTGTTCGCGGCAAGAGAATAAAGACATTCCAGAGCCTCTACGAGCGC
TACTCGGGCCTCGAGCTATCCTTTCTTACGGACCGGCCTCACGCTATCCGTGGGCTCGAGACCCGTCTCCTCGACACGTT
TCGTACTACCGGTGGCTTTGGCGTCTTTGACCGTTACCTGCACCACTCTCTGCTCTGGCAGAGGCCGGCTGGAGGGGAAT
TGAAGCGCATAGAATTTCTTGAAGGGATGCCCAAGCCACCGTCCTGGTCTTGGATGTCTTATTCCGGAGTCATTGAATAT
ATGAAGGTGCCACTGGGAAAAGTTAGCTGGCGCGACGACATCAAATCGCCCTTCTCGCACGATGGGACGCAAGATGGCCA
AGTTCCCCAGCTAGAGTGTCCCGTTTGGTACATTTCAGATACAGATGATGGGGAGATATACCTGGACGAGCCGGAACGTT
TCCCTCGTCCTTGCCAGTGCGTTGTTATGGGAAAGAGTGCGGAACAGCCCGATGGTGCTGACCAGCTGCATTATCTGCTG
CTGGTGCAACTTGTCGAGGGCCGCGATATCTACGAGCGCATGGGAGTGGCCATTCTTAAGAGAGAATACATTCATCTTCA
AAAAAGCATGGAAGGCCGGATTCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62