GenePrediction:GLEAN_3161 Details

Name: GLEAN_3161
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:659920..660816 (+ strand)
Length: 897
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:659920..660056 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_161:660127..660236 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_161:660305..660816 (+ strand)
Length: 512
>GLEAN_3161 class=GenePrediction position=GCSC_161:659920..660816 (+ strand)
ATGGCAGCAGCAGAAAAGTCAGCCACAGAAGAGGCATATTCCGGTCCCTCCGTGCGCATTCCTTTCAGTGGATTCCTGTT
TGACATGGACGGCACAATCATCGACTCTACCGCGGCCGTGGTCAAGCACTGGTACACGTGAGTTGGTGGATGCTGGATTT
GGAGGGCAGTGTTGCAGGCAGGCTGACTTCGGTTTGGTTCTCCTCAGTGTTGGCAAGGAGATTGGCGTAGATCCAGAAGT
CATTCTGGAGACGTCACACGGCCGCCGAAGCATTGACATGCTCAAGATTCTCGCCCCGGAAAAGGCGAACTGGGAGTGTG
AGTGCCGGCTGTGGGGCCATGTGCTTTTTTTCTGCGATTCTCTCCTGTTCTGACGCCGTTACCAGATATCTGCGCGATGG
AGGGCCGCCTTCCGAAGCTGTATGGCGAGGACGCTGTCGAAATTCCGGGAGCCCGCGCGCTGATCGACGAGCTAGGCCGC
CTGGACCGCCCGTGGGCCATTGTCACGTCGGGCTCGCAGCCGCTGGTGACGGGCTGGCTGGCCCGCCTAGGTCTGCCCAC
GCCCGAGCACCTGATCACGGCCGAGTCCGTGGCCGATGGGAAGCCCAACCCAGCCTGCTACCAGCTGGGCCTAGAGGCGC
TCCAGCTCACGGCCGTGGCCGAATCTGTGCTCGTGCTCGAGGACAGCCCCGCCGGTATCAGAGCCGGCAAGGCGGCCGGC
TGCAAAGTGCTCGGCCTTGTCACCAGCCATACGGCCGAACAGGTCGCTGCAGCCGGCCCCGATTGGATTGTCAAAGACCT
CACCTCCGTCCGGGTGGTCGAGCAGCAAGCTGCGGCCGGAGGAAAGACCTCCACTACGTTGGAGTTTTCCAACACGCTAG
TGCTGCCCAATGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62