GenePrediction:GLEAN_3163 Details

Name: GLEAN_3163
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:667286..668744 (+ strand)
Length: 1459
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:667286..667812 (+ strand)
Length: 527
Type: CDS
Source: GLEAN
Position: GCSC_161:667875..668138 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_161:668204..668325 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_161:668376..668454 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_161:668534..668560 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_161:668636..668744 (+ strand)
Length: 109
>GLEAN_3163 class=GenePrediction position=GCSC_161:667286..668744 (+ strand)
ATGTCTCCCCCTACAGCAGACGTTGATCTGCAGCAGACAGTCGTCCCGATCCCCGCCAGCAAGGCTTCTGGTGCGATCAG
GAGCAGCAGCAGCAGCAGCTCGCAGCTCGAGGGCCCGCTGGCATACACCGGCCAGTTGGACCAGTACGAGCACTTTGACG
TGACCAGCGCGATCGGACGCGAGTTCCCCACGCTGCAACTGACAGACATCCTGGACGATGACGCCAAGATTCGCGACCTG
GCCGTGCTGGTGTCGCAGCGCGGCGTCGTCTTCTTCCGGCGCCAGGACATCGGCATCGACGACCAGAAGCGACTGGGCCA
ACGGCTGGGCGAGCTGACCGGTAAGCCGGCCACGTCGCGCCTGCACCGCCACGCGCTCTCCAACAGCAAGCGCGGCATCG
CCGTCGACGAGAACGGTCGGCTGGACGATGAGATCTCTATCATCTCGTCCGAGCAGAACCGCCTCATCTACCGGGATCGC
TTTGGCAGCTCGTCCCGGCGGCTGGCTGGCGTTGGATGGCACGCCGAGTGAGCCAGCTCGTCTTTCCTTGTGTGTCTGTC
ACTTCGCTGTCCGCATGCTGACCTCGCAGCATCACGTTTGAGAACATCCCCTCCGACTACGCCATCCTCAAAATTGTCCA
GCCGCCCGAGGACGTCGGTGGCGACACACTCTGGGCCTCGGGCTACGAGCTGTACGACCGCCTCTCGCCGCCGATCCAGA
AGCTCACAGAGGGCCTGACTGCTACCCACCACCAGCCCGCCTTTGTCAAGGCCAAGGACACCTTTGGCATCGAGCTGATC
AGCGAGGACCGAGGCGCCCCTGAAAACAATGGCCTCGACTTCAAGGCCGAACAGTATGTTCTCTTATCTCCCTTTCTCAG
CCTCTTGCTCCGTTTATAATTGCTTCTGACATCGCTAGTCCTCTGATCCGCACAAATCCGGTCACAGGATGGAAGAGCCT
GTTCGGGGCCGGTCATCAGGTCGATGCCGGCTGGATCAATGGCGTTAGCGAGCGCGAGAGCGACATACTCAAAGCCTACT
GTGAGTCCGTTGAGGAACAGATAGAAAGCTGCACAACTGACAGCCTTCAGTTCTCCAGCTCATTACGGAGAATCACGACC
TGCAGGTCCGTTTCCGCTGGAACAAAAACGACGTAGCCATCTGGGACAAGTATGTTTCCAATCTGCCGACAGGACTGGCC
TATACAATTTATATACGGTATTTTGCTGACCATTGCTCCCTGCTGCAGCCGCTCGGTCTTCCACACTGCCACAAAGTGAG
CAATTTCCTTCACTCTCGCTGCAAATGAGACGTGCCCCTTATCGGCAGCCCGGACTAACCGTTCTTGCAGCGATTATATC
GGGAAGCGTCAGGGCAACCGGGTGGTCTCTCTTGGTGAAAAGCCGTACTACGACCCCAATTCAAAGTCCCGTCGCGAAGC
GCTAGGCCTCGAAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62