GenePrediction:GLEAN_3165 Details

Name: GLEAN_3165
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:688611..691785 (+ strand)
Length: 3175
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:688611..688847 (+ strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_161:688907..689656 (+ strand)
Length: 750
Type: CDS
Source: GLEAN
Position: GCSC_161:689713..691057 (+ strand)
Length: 1345
Type: CDS
Source: GLEAN
Position: GCSC_161:691118..691785 (+ strand)
Length: 668
>GLEAN_3165 class=GenePrediction position=GCSC_161:688611..691785 (+ strand)
ATGTTCACCTCGCACAGCCTGCCGCGCCTCCATGCGTCTGCCGTTGACGATGGCCGTGTCGGCCTCGATCTGCACCGCCG
AAATGGCTCCTTGTCAGCCCCTCCTCCTCATGGCCACCTCTCGCGCAAGAGACGCAGCGACCAGGCCCTCCTTCCGGCTG
AGGATTCCAAGCGAAGACGGCAAAACAACAAGCTCGAGACTGCCGAGGCCCTCCTGAAGCCGTCGATTGTCGTGCGGGTG
AGTGTTCTACCGAATTCGAATTTCGATTCCCCGTTGCCTCAAATCTGACCCCATAGGCACATCCTCCCAATCCCCTCTCC
AAGCCGTGCACGCTGCTACCGCTGATGTTGCTGCCGCGCGAGCATCTGCCGCTGTCGCTTCTCGATCTCGCCGCCCCGCA
CGGTGACCTCCCCTCCGGCCGCCAGTTTCAGTCCCACATCCGCATCCTCGACCTTGAAGGACGACTGGGATCCGATTTGC
TCATTGCTCATGCCCACTCGGGCGGCGCTGCCTTTGCCATTGAGCGCGATCGCTCTGACCGCTCCGATCGCTCCGACCTC
TATGCCCTCTGCCGTCTCGGCAGCTGGGTCGACCTCGGTCAGCTCAGTCGTTTGGCCACGGCCGTCTGTCGCGAGCGCAT
GCCGTCATGCACGCCGGTCGAGACTGATGGCACGATCGGACAGCCCGCCGCCCTCATCACCGCCCAGGGTCACAAGGAAC
AGCGCCGACGCCGGCTCGCCATCGAGGAGCTGCAGTCTATCGTGAGGCGCCGCCCGACGTCGTCGACCGTCGGCTCGCTG
CCAGAGGTGGCTCTTGTCCAGCCAATATCTCCCTCTGCAGACGGAGAATCACAGACACAGCTACAGACACAAACGCAGAC
ACAGGCACAGACACTGCCCTCCACCCATCTCCCTACTCCACCAGAAACAAGCATACAGCTTTCACCTGCAACCGGATTGA
CCTCTGATCAGGCAGAGCCTCCAACGGCCGACACAATCTGCCAAAATATTCGCAACCACTATTTTGAGGCTCTGTACCAC
TCCATGGTGTGTTTCGTTTTGTCCTTTCTGTCCTCTCTGTCTCCCGTGCTCACCAGATCTAGGGATCGCTTGCATATTTC
GCCAAGGGGCCACTGTCCCGGGCACGCGCCGCGTTTCATCTGGACTGCGACTCGAACCTAGAGATGGACGATCTCATAGA
CTTTCTCAAGGGCATAGTGCTGACGACGGCGCTCATCGACAAGAAGTACCGCGAAACTGTCCCAGAGCTGGTGGCCCGGC
TGCGCATGCTCGGGAACACGTCCGACCACGAGGGGCCGAAGAGGAAGACGTCCAAGAAGGCGAAGAAGGTCAAGCGTGGA
AGCGATGGACTTTACACGGACGAGGAGCCGCACATCCGCAAGTGGTGGAGTGCCAACAAGCCGGAGGTGCACGATGAGGA
AGCAGTGCCGCGGCCAGAGGAGGTGAAGTACGCGATCTCGCAGCTGCGGACGCGGGAGACGCAGCTGCAAATGATTCTCA
TCCTGGAGATCCTAGCGCTGGAGACGATGCGGCCGGCGGTCGGCGATGAGGGAGAGAGTCAGCTGCCGGGGATGGGGGCG
AGCGCAAGCAGCACGCCGCCGGCAAAGCGAGAGGCGGCCAAGAAGCGAAGCAAGCACAACCTGCCGCTGCTGATTGACGT
GCACGCCGACCGACTGTGCATCTGGCAGTCGACGACGGCCGACGACGTGCGGGCGATGGCCGAGTCGCAATCGAGGGACA
GCGGCGAGGACGGTGTGCAGCGGTCGCAGCATCCGCTCCAAGACTTCTGCGTCGACATCATCGTGCCCTTTTTCTCGGCC
CGTTTGCCGCTGGTGTGCGAGTCGCTCAATTACAAGCTCGGCGGGCCGGTGGTGGCGCCGCCTTCGCGACCAAAACTGTC
GAGGATACCGTCGATTAAAGCGGCCGAGAGGCCGTCGTCACGAGCACGACCAGGCACGGCAGCACGGAGGCTGGCGCCGG
CACAGTCACAGCCATCGTCAGCACGGAGTCTGGAGCGAGTGCTCTCGAACGAGCGGCTGCGGCGTAGTGTGTCGCGGGGG
CCCAACGATGCGATTGCACAGATGCGCAGCGCCACGGCAGCGCCGATCCCGGGACTGAAGCGGGAGATGAGCGAGCCGGG
TCCGTTGACAGGGATTCCGCGGCGAGGATCATCAGTGTCACTTTCGGCGTCTATGTCGACGACGTCGACGTCGTTGCGCG
AGCGGCCGACTAACATGCTGAGTCGAAGCGTCTCGGACGCGGCCATGATGATGCGCGGCAGCGCTGAGGATCCACGGACC
CGCAAGAAGGCGCAGGTGGAGTTTGAGCTGCAGGAAGCGATCACGGCGCTGAAGAAGCCAAACCGCGGGCTGGCGGGCAA
GTCGGTGGTAGAGGCAGCAGAGCGGCGGCTGGGCGGACAGATTCGAAGTGAGTGTTACTGAGGCTGAGATGAGGTGAGAT
GATCTGATCTAGATGCTGACCGGACAGGAATCAAAAAGAGCGGTCCTCCCAAGGAGCGTGTGCAGGTCAAGGCGACGCCG
GTCAGCCATCGGTTCCGCGACGTGTTTGGCGGCGTCAGCAACAGCTTCGACGACAGCGACGGCGACTATGACGACGACGG
AATGCTGCGGCTGCCGGGAGCACGGGCACAGCAGCTTCTGTTTGCGGCACATCCGCATGCTGGCAGCCAGAGCCGCGTGG
CAGCGACGCCACTGACCGGCCGCGTGGTCCAGGCGACGCCGGCCCGGGCATCGGTGCTGGAGGCGGTGTCAGAGACAGTG
ACAAAGGCGACAGCAACTGTGGCCGTGACAGCATCGCCAGCACAGAGGCTAGAAGATGTCGTGCTGCTATCATCGCCGCT
GCAGGAGAGACGACGACGGCCACTATTTGCGACACCGACAAAGAGGGTAGGGGGAGGGGGAGACAGGGGAGACAGGGGAG
ACAGGGGAGACAGGGGAGACAGGGAAGAGACAGAGAGGGCAGAGAGGATAGGGACAGAAAGGGCTGAGACTGAAAAGGCT
GAGACTGCAGAGACGACACAAACAGAAACAGCAGTAGCAGAAACACCAGGAAAGACTGGGATGCCGACAACCGAAAACGC
ACAGACGCTGTATCAGCAGCTGGGATGGGACGACGACATTGACGACCTCGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62