GenePrediction:GLEAN_3166 Details

Name: GLEAN_3166
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:700920..702392 (+ strand)
Length: 1473
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:700920..701882 (+ strand)
Length: 963
Type: CDS
Source: GLEAN
Position: GCSC_161:701958..702392 (+ strand)
Length: 435
>GLEAN_3166 class=GenePrediction position=GCSC_161:700920..702392 (+ strand)
ATGGCTCTCGCATCAGCAACGCCATCTTCCTCCACTGTATCTACTGCTACTAACACCGCATCCACAACCACATCTCACCG
AACGCTTACCATCACACTCAGCACCGTATTTTCCGTTATTGGTGCCCTGCTGCTTGTCGGTATTGGCTTTGCTTGCTGGC
GTCGCCGTCGCCGTCGCCCTCTCTTTCCTCGGGGCATATCTCCTATCGATGACGATGAGATCGAGACGTGGAAGGTTGGC
CAGGCGGACAAGGCCAGCGAGGCGGGGGGTGTGATCAGTCAGGCCAACGGCGGAGAGGAAGGCCACGGCCCAAGCTGGCC
CCGGGCAGCTGCTAGACACTGGAGCGGCGTTTCCCAGAGAGCGAGAGCGATGACAGTCGAAGAGCAGTACGCCCACCAAG
CCAACACCCAATTGACCCGACTTCGTGGCATCAGTGTCGACAGCGGTGTCTTTGCAGCACCGCCACTCAGGAAGTCGCCA
TCCAAGGTGATCATCGACGAGGAGCCATCGACACCACGCCAATACTACTCGACCTCCTACGGGATTCCGGAATCAGCTGT
GACGGTACCGTTCCCCAGCGTCCCGGACTCACCAGCGGCTATGGCTGCCGGTGCCGCAGCAGCCTCTTCGTGGAAGCACC
AACATCGGCAATCGGACGATCTGGCCTCGCCGCGAACAGGTCGATCGGCTAGGTCTCTCTCGCTAGAACAAAGTGCACGC
CCGCCCATAATAGGCCGCTTTAGCCTCGACCAGGACCGGAGTCGGAACTCTGCCCTGGCGCAGCTGATGCCACAAGGCCA
ATTTCCTGGCACACAACTGCCGGCTGCCGTACACGCCCGTGCTCCCAACTCCCGGCCTGGTTTGACGGACGAGACAATCC
CGGGCGACCCATCGTTTCTGCCATCGCCACGGCCTCTTCGGAAGCAAACATCGCGGCTGGTTAAACAGCCGCCCATGGCA
GTAGTAGGAGAAGGGAGAGGGAAAGCGATTTCTTCTAGTGCACCTCATGGTAGTTCACAAGGCCACTGGTCATCGCAGTC
AGGAGCCAGCAGCATTTCCGGAAGCCACTCGTTTTGGCATGTGCGAACACGCAGCGGTCGCAGCAGCAGCGTTGCCAGCG
GTCGGAGCTTAGGGTCAGAGGTAGGACTGCAACAACAGTCACAGCATTACGAAGAGGAATACGAGGAAGTGCCGCCGTTG
CCATTGGCACCAATTCCATCACAGGTCTCCCAGCCGCATCGAAACCGGTCGACGAGCAACTTGGCTCAGACCAATGCCGA
CGGCAACATCAACAGCAGCAAGGGCCACGGCTACCTGCACCACCAGCACCCCCGATTCTATCAAGCATCTGTTCCACCTC
AGCTGTTGCTTGACGACGACGACAACAGCGACAACCAGGGAGCAACTTTGGGAGGCTTGTCGCCGCGCCCACGGGTGCCC
GACCAGAGCAGGATTGGTCGAGCGATAGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62