GenePrediction:GLEAN_316 Details

Name: GLEAN_316
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:987555..988948 (+ strand)
Length: 1394
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:987555..987664 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_167:987727..988948 (+ strand)
Length: 1222
>GLEAN_316 class=GenePrediction position=GCSC_167:987555..988948 (+ strand)
ATGGCAACGACGACAGCAGCGGGCCCCGACTCGAGCTGGGAGGTGGACGACGCGGCCATCCAGGACCCCGAAGAGGTCAA
GGTGCTCTTCTGCGCGCTGGACTCGTTTCTGTGAGAATGCGGTTTGGACCGTCTTTCTGTCTTTGCGGCGTCGACACTGA
CAGCAGTGGCAGACAATATGCAAAGGTGTCGCACTTCCACTGCACACACCTGCGGCGGCAATCGTTCTACGCGCTGTCGC
AAGAGCACTGGCAGATGCTAGCAGCACCGCCGTTTTCGTATCTGGAGACGCTAGACCGGGTGGATGACGCGATTGAGAGC
AACGCGGACCTGGCGCGGGCGATTGTGCGTTTTGGGCTGGAGTCGTTCTGTGGCGGACAGCCGCCAGGGCCGACCGAGTC
GAAAGAGGCCCAAGAGGCCAGAGCGGTCAGCGAGAGAGAACCGTCGCTGCCAGCGCCATGGGCAGGTATAGCCAAGCATA
CGGATGTGGACAAGGCACGCAGCACGCTGCGGCAGTTCTACCGCGACTGGTCGGCCGAGGGAGCGGCAGAGCGCGAGCAC
AGCTACGGGCCGGTGATGCAAGCGCTGGCAGCGGAAAGGACGGAGAGGACGAAGCGAACAAAGAGTCTGGCGACAGCAGA
AGGAGGAGCAGAAGGAGGGGCACCCCTGGAATCTCTGAAAGTGCTGGTTCCTGGGGCTGGCTTGGGTCGGCTGGTGTTCG
ATCTCTGCTGTGCTGGCTATGCAGCCGAGGGCAACGAGATCTCGTACCACCAGCTGCTGGCGTCATCATACGTGCTTAAC
TTTGCCCAGCGTGCCGGCCAGCACGCCGTCTATCCATGGGTGCACTCATTCTCGAATCACGGCACACGTGCCCGCCAGCT
GCAGGCCTGCCGTGTCCCCGACGTGCATCCGGCACAGACGCTACAGACGCTACAGCAGACGGCCGGGTCCATGAGCATGT
GTGCGGCCGACTTTCTCTGCCTGTACGGCGACGAAGAACACGCGGCCACGTTCGACGCTGTCGCCTGCGTCTTCTTCCTC
GACACGGCCCCGAACTTGATCCGCTACCTCGAAACGATGTGGCACTGCCTCCGGCCGGGCGGCCTGCTCGTCAATGTCGG
CCCGCTGCTGTGGCACTTTGAAAACCACGCACCAGGCAACCACGGCCGCGATGACGACGGCGACGGCGAGCATGATGCCG
CCAGCTCATCCGGCATCGCCGATCCTGGCAGCTTCGAGCTGACTGACGACGAGGTCATGGCCCTGGTCGCCCGCATCGGG
TTCCAGGTCGAGACCCGCGAGACCGCCCGCGAGACGCCCTACATCCACGACGACCGCTCCATGCTGCAGACGGTGTACCG
GTCGAGCTTCTGGGTGGCGCGGAAGCCGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62