GenePrediction:GLEAN_3170 Details

Name: GLEAN_3170
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:716863..720208 (+ strand)
Length: 3346
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:716863..716978 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_161:717085..717400 (+ strand)
Length: 316
Type: CDS
Source: GLEAN
Position: GCSC_161:717469..717724 (+ strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_161:717796..717915 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_161:718148..718171 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_161:718254..720208 (+ strand)
Length: 1955
>GLEAN_3170 class=GenePrediction position=GCSC_161:716863..720208 (+ strand)
ATGCCGATCGCCAGTAGCAGCCACTCGAGTCTGAAACTAGGCACAGAAGAGAAACGGCCAAATAAAAGCCAGGCTCGGGA
CGCTTCCGTTGTCCGCGTTCAAGATGTATCGCACATGTGAGCACACCCACGGATACAGAAAGTGGCCCACGCGACAGTGA
ATCAGAGCAGAGGACGATAAAGGATAAAAGCCTGAGCTTCTTCGTGGCTAACAAGACCCCAGGGATATATGGAAGAAAGC
TGTCGAATTGGCACACGACGACTCCAATCATCTTAATAAAGAGGAACTGCTGCGCATCGACAAAAGATGTGGGGCAAACT
CTATATCTGCTGTTATCGAAGAGGCCAATACAGCGAGAGTTAAACTCGTTATGAGTAAAATATCATACACCACCTCTAGC
GGCAAGAAGATAGCCGTGCAGGAGAGAGTTGAATGCCTGCTCAGAGGCTTACAGAACTACACGGGAATAATCGATGAAGT
CGTTTCCACGTCCGAGTATGCCGGCATCGTGTGGGCTTCCATGAAGTTTTTTCTCCAGGTTAGCGGGCCCTGCTCTTTTG
TGGTCTTTACTCTGTTTCTTTTCTAGGCTGACTTTGTTTGCAAAAGCTTCTCTGGAACAAGATTGAGATGCTAGAGATGC
TAGAAGAAGTCCTTGCTCGGCTCACGATGACCATGGCGGTCGGCCAAGTTTATGAGAGCATCTACTCGGAATGCCAAGAG
CTAACGCAGATGCCGGAGCATAATGGGGATGCCACTGTTCTGGCCAAGGAGATGGAGTCGGCTCTTCCAAAGCTGTATGC
CGCTGTCCTGATATTTAGTACCAAGGCACAGTCATACTTTCAGTCTGCTCTCAAGTTCACTGGTAAGAGGACACTTTTAT
ATGGGGGGGGGGACTCTCCAGGAGATTGTGGGGTCTAACGTCCGTCAACTTAGGGGCAATTTCGGCTGCAAGGCCGTTTA
GCGCTCAGTTTCAGCCACTTGTCGAGAACATCAACAAGGGGCAGAAGACACTGGAGAAGCTAGCAACTCTAGCTACTTTC
CAGACGATCAAAGGTAATCAGCTATTCCTCTTTTGTCTACTCCAGCTGCGCCTCTTCCATAGCCCACATACCACCGTCGG
GCAATTAAAGGACCATTTGTCTTTCATTTTCCTTTCAGTCCACTTGTCAATCTTTTCGTTGTGATCATTTTAAAAGTCTA
CTAAGCAAACCAAAAACCGACCCAGAAAGCTCAAAAACAGTTCAAACTATGCAAAAGCAGCTCAACTCGGTTGAAACAGC
TCTAGCCCCCCTAGAGACGCAATTAAAAAGTAAGAAGCATTTGTTGTTCGGACAAACAATCTTCAACTGTTATACAGGTG
TACTGTTTCTGACATTCGGTTGTGGTTCCAGAAATCTACAGCCAAGTCCTAGACACTAACAACGGAATCCATGCTCTGCA
ATCGGCAGAAGAGCAGCGGTCAGAACGTAAGAGACAGTTGCCCGAGTCTTGCCGCAACACGATTAGCAGTGCACTGTTCT
TGTTTGCTGACGAAGAACCGATTATAGAGCTAGCGCTAGAATGGCTCGACGCCCATGATCCAGAGGACAGCCTTTCCGAG
TATAAGAGCCAGCGAGTGCAGGGGACCTGTGAGTGGATTCTCAAGGCTCCTGAGTATCAGCAATGGCAAGCCGCCTCCCA
GCCTGAGAACCTGTGGATTTGTGGACAAAGTGGCACTGGAAAGACCATGCTTGCATCCTTCCTGGCAGATTATCTCCCGC
GAGTCCAAGGCCAAGACGCGCTCGTCTTCTTCTTCCGGGCCGGCAGCGCAAAGGAAGCTTCGCCGGTAGGAGCGCTATCA
AGCCTCGTCCTCCAGCTCATTCGACTCGCTGGGAGCGACGACACCGATCCGGCTCTCCGGGCCCAACTCTTGAAAATGCT
AAAGGGCACTGTTAACAAGGGCATCGGCTTCACGAACCGGGGAAAGACGGTGTTGGCGCTCCATGACCTGCTTTCCGAGA
TGCTCACGACGTTTAGCGCTCACAGGTCGAGACGGGTGGTCGTGATCCTGGACGCGCTGGATGCTTGCTCTGACCCTGTC
GCGCTTAAAGGGTCTCCTGACTCGCGTCTGCAGAGTGCTGCGTCCCTGATCATTACTAGCGACCGGGCCGGACAGGAGTC
TGCCGCTGGCATTGTTCTATGCTCTCCTCTGCAGATGGCTATCTACGACGACATCAAGCTGTTTGTCGATGCTAAGTTGG
CCGCAGCCGGCTGTGCTCATCTTCGTCCCCACAGCCAGGAAATCACGGCAATCATCCGCAGGTCCAACATGTTTCGCTAC
GGCGTCGTCCTGCTTAGGGACCTCGCAAGCCTGTCGCCCGAGACGGTCTCAGAACGCCTGGCGAGCCTGAAGCTAGAGCT
GAACGACATGCAGGACAGCCACATCGGCTCACTTCCTTTAAGCACGCCGCTAAGTCAGGCCGTGCACCTGGTCGACTACA
TCACTCTCAGGATGTACCTTGAATATGCGGAAAAGCAGCAGCAGCAGCAGACACCAATCTCGCAGCAGCAGCTGTCTCAG
GCCATCTCGTCCGCCTGGAGCCGAGGACGCCACGGGGCCGTCAGAGAGCTGATGAGCTGCCGTGGAGGCGCTGAGGCGGC
GAGCGAGCTGCTGTTGTCAGCAGCACAGCGCGGGCATGCGGACCTGGCCCGGCTGCTTTTGAGCCATCGAAGCGTCCATG
CGGATGTCCGGAACAGTGGAGGGCGCACGCCGCTATCGCTGGCCGCACAGGCAGGCCACGATGACGTCGTGGAAGCGCTG
CTGGCACGGGCCGACGTCGATGTCAATTCGCAGGACAACACAGACGACACGCCATTGATCTGGGCCGCCTATTACGGGCG
GACGCGGTGCGTCGAGATGCTCTTGGCGCGACCTGGTATCGATCCCAACATCTACAATAACTACCGGGACTTGGCGCTGG
TGTATGCAATTCGCTACGCCTTTGTCGACGTGGTCCGCCTGCTCCTGGCGTCACCCTCAATCAAGGTCAACAAGGGGACG
CTAGGCGGCAACACAGCTATCCATGAGGCGCCGAATCGGGCGCCGTCTGGTCCGCCTGAAGGCCGCCGTGCGCACTACGA
GTGCCTAAAGCTCCTTCTCGGCCGTGCTGAGCTCGATGTCAACGTACGCCGCGACGGAGGACGGACAGCTCTTGCCACAG
CGACAAAGTGGGACTTTTACGACCAGGTTGCCCTCCTTCTGACGAGAGACGACGTAGACCGCCATCCAGTAGACGACGCC
GGAGAGACTCCGCTAGCCACGGCGAAACGGCTCGGCTACAATCAGATTGTGGCACTTTTGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62