GenePrediction:GLEAN_3171 Details

Name: GLEAN_3171
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:724638..729144 (+ strand)
Length: 4507
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:724638..724732 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_161:725219..725415 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_161:725480..726220 (+ strand)
Length: 741
Type: CDS
Source: GLEAN
Position: GCSC_161:727517..729144 (+ strand)
Length: 1628
>GLEAN_3171 class=GenePrediction position=GCSC_161:724638..729144 (+ strand)
ATGGCTTCCTGGTCAACTGCGGACGTTCCAACCCAGAGCAGTTCGAGTGCCAACTGGGCAACGGGCGGGCTTACCATCCC
TCAAGCTCCGACCCAGTATGCTTCTATTTATGCTTCCGTTTCCCCGAACTCTCCCCTGCAGAGTCCCTTTAATACACGTG
GAACACACGGCGCAAGGCCAGGAGACGCGAGTAGTAGCGGAAATGAGTTTCTCAGGTCCAGCTTCCCACTTTCCTCTCTG
TTGAGGAACTCGTACGCAGCCCAAGCTCTTACGACTGCTAGACCTCCTCCTACTCAGCCAACTCGAGGGGACCGGACAAC
CGCGACCGTCAGAGAAAATGTTCATGATAATTCGACGCAGCGGCCACCCCGCAGGCCTAAAACACGTGCGCCCAGTGCTG
CACAGTGGCAACAGAACAAAGCACGCATTGAGAAATTATATATGAACCAGAAATTACCGTTGTCAGAGGTAATGCAAATG
ATGGAACGCGACCATAAATTCTCCGCAACGTAAGACATGCCGCTTGCGCTCCTGTATCCTGCCGAGACACATGTGGCTGA
CGCATGCTCTGATTGTAACAGAGAGAGAATGTACAAGAACAAGTTCACGGCTTGGAAATGGTCCAAAAATCTGACCCAGG
AGAAGGCCTCTTGGATGGCCGCGAAGATCGAAGCACGACAGCCCAAAGAAACAGTTTTCTCCCACAGACATCAAACGTGG
ACTAAGGAGAGCCTTGAACGGAAATTTGGACAGGATTTGCAGAGACGGCCTGTAGACTGTGAGTCGTCCATGTCTTGTTG
AAGCATACGACCTCGCTAACGGGTGCGCTGCAGACGACCCAGGTCCGACTCCAAACGGCATCACTTACCAGACACCCTTA
TCACCCAATGAGAGTCTGCAGATGTCCTACTCCACTGCATCCAGGTCACCTGCTCCGGGAATTGAAGAAGTTGTGCAGCC
TATTTTCTATCTCGACAAAAAGCCGCTCCGCTTCCATCTGGTCCGTCCAACGGTACCCGATCTGCGAAACTTGCTCGACG
ACGCCTCCCGTGCAGCGTCTGCCAAAAACTATGTCAAGGCAGATGCAGATTTTCGAGAAGCAGTCTCAGGATTTCGCTTT
TTGCTGTCACCGACCCACGAAGAAACTCTCAGGGCTGGATACGAGTATGCTTCCTTCTACGCCAAGTCTGGCAACATGGA
CAAGGCAGACGAAGTGTTGGACTGGATGTCAGAAAACCATGTCTCGAAATGGCACCATGGGCATGAAAATACCTGCCTCC
ACTATTCGCGCATGGCAAAGCTGTTTCTAGATTGGGGTCGCCAGGAAGATGCCGAGACTCTGGTGTATAAGATCTTGGAT
GGTACGGGGGATTATATTACCGGGGTGCTCCGTTCAGGATCCCAGCACCGGCACTCAGTTGCAGATATTGACCTCGAGCA
ATCATTCCTAGAGACAGACGATTCCGAGTCGATGAGGCGTCAGCTCGAAAAATTAGATCTCGCCATCACGACAGGCATTA
CAGGACTTGATAACATTCTCGAGGTTATTCTCAAGCAATGTGAAAACCATCCGGACGATATGCGTATGGCTTTAAATGCT
TGTCGAGCCAAATGCGCACTTGCAAAGCTGTACAGTGCCGCTGGGAAAGCCGAACAAGAGCAACAAGCCCTCAAAAACGC
GTACAGGTCACTCGAGCCACTTCTACGTGTGAGTGAGGAGCCCATATCGCGAGATACCATCGCTATAGCAAGACGACTTT
CTTTTTTACTCTTCAAGGCGAAGAATGAGCTATGGTGCAATGCTGTTCTTGAAAAAGTCATCTCCTCGTTGACGGCGCAG
CGCAGTATCCCTACCTACAGGTCTCCAACAATCGACACCTTCATTTTCAACTTTATTTTGAAAATCGCATTTCAATTTCA
TGAGGCTGACTCATGGGATAAATGTCGATATTGGCTTGAACGGGGCTACGGTCTTGCTATACGGCTACTTGGGCAAAGAT
CTCCAGAGGCCCACAAATTTGACAAAATACTACGCAAGAAGGACTTCGACATGCGAGCTTCGACGAGTATTCACGAATTA
ATGGACTTCTCAGGAGGTCTCTTCTTCGTCAATACTGTCTCAACCTTGTCTTCGTGGTAGGCCTTGTCTTCCGAAAGTAT
ATCGGAGATGTGGTGGCCTCACTTGAGTGTTGCTGAGAGGATCAAACCCAACTTTAGCAAAACCCTTTAGAGAAAGATCT
GTGATACGTATATCAGTCTCTAGGATTGCAATTCATACAGACGTACTTATTGTACATTCGCGAAGAGTAGCTCGGGCTAC
AATCAGAAGTGAAAAATACAGGTTTAGCAACATAGTTGGTTTTTCCGTACAAGATACTCCGTACATAAGATCAGATAATA
CATTGCCAATGTGCTCGTACAAGTAAGTACGCGCGACGGTATTTGTGAGCATCTGCCCCGCAGTCCAGATTGGCGCATTA
ATTGTTCGTGGGGCAGGTTGACGGATTAACGATCATCCGGGATGTCTAAAGAAAATCGGCCCACGATAGCTTACAGCCGG
CACAAGTTCTCAATCGCCGGCCACTGCACACGTGCATTGACAGTCGACAGGACGCACTGCGGCGTTCAAACTGCAAACAT
GAGTGCGCTGCGAGGCAGTGTGCGGTGTTCAAGTACCCGGCTGGTGGGCAGCACGGCAGCCATCGGCACGTCCTGGTTAG
GAAGAGCAAGTCTCGGCAAGAGCAGCAGATCCAACCACGCACTTTTGGCACGGGTCCTCGTGACTGCGTGTCGTCCGTCT
TCTACACAAGCCTGTGCACGATGCACGACGCCTCCATACGCAATTGACCATCTGCGACACCGAGACCCACACAGCACAGT
CCAGCGGCCAGTCGGAGCGACACGGCGACGACCAGCAGGAAGCGCTCGCACACTTTTCACTTCGGCCGTTCCCAAGCACT
ATGTCGACCTTCCACCGACCTACGAAGACGACGTCGGACTCCCGTTTCGGCGGGGCGGCGACCTGGAGCGACAGCAGGTG
GCAGAGATATTCGGAGTGGGGATGAACCCCGCAGTGGCAAACCGACTGCTGCGCATTCTTCACGGTCGACGAGTAGCCGG
CACGCTGGACGACCCGGCATATCGCGTGAACACGGCACGGTATCCGCAAGCAGAGATCGACGCGGCGCTGGCATATCTTC
GACGGACGGTGCCGGTGGACGAGGTGATCAACGCGGGCCTGCGGGCAGAAGACGAGCTGGCCGAGCTGGAGCAGGGCGAG
AGCGAGGAGACGACAGAGGCGGAGACAGAGGAAACAGCAGAAGATGGACATGCGTCTGGGAGGAAGAAGGCGCTGCAGAG
CCTGACAGAACACAAATGGCGGGCGCGGCTGTTCCGCGAGGCGCCGTCGGACGAGGTGTACGGCATGGGGGCATTTGACG
CGATTCGGGCGCGCAACCGACTGAAGGAGGAAGAGCGCGAGCGGCTGCGACAGGCGGAGCAGAAGCTGCGGGAAGAGGAG
GAGGCGAAGCTGGCGGCGTCACGAGGGGGAGGCCGCGGGCTGGAGCGGGTGGACGGCTCGAGCAGCAGCAGCAGCAATGG
CGGTCGCTTTGGGCTGCGAATACCAGACCGCGAGATGAGCCCACAGATGCAAAAGTGGGCCGTTGCAGCGACATCACCGC
TACAGGAAGCGCCGACGATGTCGTCGTGGCAGCGGCTATGGCCGTCGACGCTGTTTGTGGTGTCGCTGGTGGTGGGTGGC
GGCGTGGTGGCGAGCGTGTACGAGCCGCCGGCCGAGGAGCAGCGGCTGGTGCCAGGACTATCATCAGCGACGACGACCGT
ATTGGGACTGGTGGCGGCTAACGTGGCTGTGTGGCTGCTGTGGCGCGTGCCGCCAGCCTGGCGGCTGCTCAACCGCTACA
TGATCGTGGTGCCGGCCACGCCGCGGCCTCTGAGTCTTGTTGGTGCCATGTTTTCGCACCAGAAGACGAGCCACCTGCTG
GCCAACGTGGCCTTTGTCTGGTTTATTGGCTTGCGGCTGCACGACGAGATCGGCCGGGCCGCCTTTCTCGAGGTCTACTT
CGCCTCGGGCGCGCTCGCCTTTCTCGCCAGCATGGCTAACATCGTCCTGCGCAACAACCTGCACCTGACGACGCTCGGCG
CGTCCGGCGCCATCTACGGTATCACCACAGCCTACTTTATGCTGCACAAGTTCGAGGGCTTCAAGATCCTCGGCCTGCCG
CCCGATCCCTACGGCGGCATCCAGGGCCTCGGCTTCATCGGCCTCATGCTCGGCCTCAACCTGCTCACCCTGCGCGCCGA
GAAGCAGGCCATCGACGTCGTCACCCACTTCGCCGGCATGGCCGTCGGTGCCCTCTTCGGACAGTACTTTAGCCTCGTGC
GCGACGAGCAGGTCCGCGCTGCCACCGAGAACCGCCCGCCGCGTCGGCTCTGGGCCGTCTTGACTGACGGCGATGCTGCC
CGCGTGCAGCCCGTGGCCGAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62