GenePrediction:GLEAN_3172 Details

Name: GLEAN_3172
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:735808..736774 (+ strand)
Length: 967
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:735808..736057 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_161:736197..736774 (+ strand)
Length: 578
>GLEAN_3172 class=GenePrediction position=GCSC_161:735808..736774 (+ strand)
ATGATCACGGCCAAATGGAACGAAGGAGTCCTTGACCTTAGCGCCGGAGACTATAAAGAGGAGAAACGACGTATGCTTGG
AAGACAGCAGCAGCTAATGACAAGCGTCTCCGTGTTGCGGACCATGGGTGCACAACTTGCCGGGCGCTGGACTGACGACA
TGGTCCTTAGTGAACGTGAGGTGCTCGATGACTGGGCGCACATCGACGACACCATCAGCCGCTACACTAATGTCCCCGAG
GCTACGAAAAGTGTGAAAGCTAAGAGAGATAACCAGAAGCAGAACAAATTCCGCAGTGATCTTATCCGGATCTATGAATC
TTCTATCCTTATTCGGAGCTGAGACCGAGCACATCTGGAACGTGAAAAATGGCCTTGTTATACACAAAGACTACGAGCGG
CTCCTGGATACTGCTAGAGCGGTCATTCTACCTGCTAGCAACGACCCAGATGAGACCGAGCTCAAGTTTTACCTGTTGAC
AAGTGACATTGGCCGGGCTTCGACTAGGATTTGGGGTGACATGTTGAATGGCCGTGAGCTTAACTTCAAGAATGAGTTCC
GGCCGTCAAAGAAATACTTGTATTTCAAGTTTGTTATCTCTCTCCTCCGCAGGCGCCGTATAGAGGTCCCTGGCTTCGAG
AACGACTTAGTCAACCTTCCGTCGCCCAGCAAAGTCATGTGGGCCTCACCTGGATCATATATGAAAAAGTCTATTCTTTA
CAAGTTCTCCAGACAGCTAGGCTGTATCTCTGTCGAGGAGGCCAATCGATTTTGGGAGGTTCCCGAAGCACCTACAGCGC
TCCCAGCAGAGCTTGAAGATCTCGCCACTACACTGGCGCTTACAAGTTCCTCGTCTATGAGTGCCGAGATTTCCGAGAGT
GAGACTGGCGAGGAGGCTGATGATGATGATCCGTTTTCGGAAAATGAAGGGGATGATGACATTGTGAACAGTGAGGATGA
GGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62