GenePrediction:GLEAN_3173 Details

Name: GLEAN_3173
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:738010..741212 (+ strand)
Length: 3203
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:738010..738338 (+ strand)
Length: 329
Type: CDS
Source: GLEAN
Position: GCSC_161:738414..739516 (+ strand)
Length: 1103
Type: CDS
Source: GLEAN
Position: GCSC_161:739582..740908 (+ strand)
Length: 1327
Type: CDS
Source: GLEAN
Position: GCSC_161:741191..741212 (+ strand)
Length: 22
>GLEAN_3173 class=GenePrediction position=GCSC_161:738010..741212 (+ strand)
ATGTGCCAGTGTCTGGCCGATCTGATGGCGTCACTTGTGCTCACAGAATCGCCAGAGAGGCTCCGCGATCCTTCTAGGAA
GGTTCAGTCAACACCGGCCGAGATCAAATTGGTCATGCTGGCCACGCGCTGTCGGGAAACGGCAATAGGCCTGCAAAAGA
AGCTCCGTTCTCTACGGCTAGACGCTGATGCACCCTCGTCCTCCCATTCGAAGATGACCAGTTTGCTATTGGCCGTCAAA
CTTAAGATGGGCAATCCTACCGACCGGCTACAGAAGAAGCTGGATGGGTACCGCAATGACCTTATGCTTTGTCTCAAGGT
CGTAGCATTGTAAGTGTCGTCCAGATAACCTTAAGCTTAAAGCCTTGAGTCGTGAGCCTTAGGGCTGTTTCTAACTTCCT
GTAGCGAAAAGCAGTCGAGCGTGGCCATGTACATGGAGGAGCTAAAGCAGGCCAATCTCAACATCGTGCACGATCACTCG
GCCAAGCTGGACGAGATGCTCGAGCTGATCAGGCAACTGCCCGCTCAGGCGGGCATCGTAATGAGGGCTGACGATCCAAC
TGTTACGCTGACGTCGATTGCCCAGGCGCTTAAGACCATTAAAGCTTCGTCGGCCCGACAGTGGATCTGGGAGCACGAGA
TCGTGCACAGCCTCTACTTCGAGTCACTGCCCATCCGCCACGAGGCCATACAGAATGCGCACCGAAAGACGTTCGAGTGG
CTGCTGCGAAGACGCAGTAGAACAAAAAAACATGGCTATTCCTACAACGCCTCCTCTACCACCACCTTGCTAAACTGGCT
GCAGAGCGGCGCCGGTATTTACTGGGTATCGGGCAAGCCAGGCTCGGGAAAATCAACGTTGATGAAGTTCGTCGTCGGCC
ACCCCGAGACGCAAAAAGCCCTCAACTGCTGGGCCAAGCGCGCGCCGGAAGAAAGCGGTTGTATCACCACAGCTTACTAT
TTCTGGAGTGCGGGCACACGGCTGCAAAAATCGGTCGAGGGACTGTTGCGATCGCTGTTGTTCGAGGTTCTCGTCCAGGC
GCCTGATTTGATCCCGGTGGCGTTTCCCAAGCGATGGGCTGTCACAGCTGGGGAGGGATTTCGGCGGAGTTCGAACGAAA
TGTCCCAGTGGAAGCACTGGGGCGAGCCAGAACTGTTCGAAGCCCTCCGACTCCTGTCGCAGCCGACCTCGCCATCGTCA
CCCGAGACTGTCCCTAGGCGGCTCTGCTTCTTTATTGACGGGCTAGACGAATACCACGGCAACCACAGAGAGCTTGCTCT
AACCCTGTCAGCCGTGGCGTCATTTGGTCAAAACATCAAGGTCTGCGTGTCGAGCCGACCGCGGAACGTTCTTGATAACA
CGATCGGCCTGGTCGCAGTGACTCAGAAGTTGCTTGTTCACGAGCTGACTCGCGACGATATTGCCGCATATACGAACGCG
ACACTCGACGAAGACCCAAACTGGGTGTTGGAGGCCCCTACCAATGCACGCTACGGACAGCTCGTGCGTGAAATCACAAG
CAAGGCACAGGGCGTCTTTCTCTGGGTAATCCTCGTCGTCCGCTCGCTGCAGGTCGCTCGCTGCAGGAGGGCCTTACCAA
CGGCGATTCGCTACACATGCTCGAGAAACGCGTCTACGACATGCCGCAGGAGCTTGGTCCGTTTCTTCGGAAAATCCTGA
TGTCCGTACCGACTTTTTACCAGCAGCGGATGGCCATCTACTTCCACATTGCCCTCAACGTTGACATGAACGAGGAGTCG
AGTCTGGTCACGCTCATGCACCTCTCCTTTCTCGACGACTGTTTCGAGACTGCGCACTACGCCAGCAGCCTCCCTATCAA
GCCCATGGATAATCATGACATATTCCAGCGGCACAGTTCGATGCGTCGTCGCCTTAACGCCCGCTGCAAGGGCCTGCTCG
AGGCCCACCTGCACCCGCCTGAAACCCAGCCCTATCTCGCCCATCGGGTTATACTTTTACATCGGACTGTGCGTGACTTC
TTGCGCACCGATGAGATGACCCAGTTCCTAGACAACCTTGTGAGCGGCCATGACACCGCCATGTTGATGCTGAACGCCTG
CATTGCATTATTCAAGAGCATTCCCCAGCCTGAACACTCCACGACGGCTACGCTCTTCGCGCAGGCTTTGTCTTATGCCC
GAAGGGCTGAGGTTGGGTCCGTTGAAACAGCTATCTCCATCGTCAATGAGCTACTGCGCTCAGCACGCACTATGGGCCTG
GGTGGGTTGACCAGCCCCTCGGAGTTCACCAAACTTGTCGTCCACCATGGGGTTTCCGGCTATATCGCTGCGGCTGTCGA
GGCCCGTGAAGATTACATATTGGATGAGGCTAGTGTGCTCGACATTGCTCTTCAGAATGCTGCCTCATTCAGGCCGGAAG
TCGTCGATATGACGGAGACAGTTTCTATGCTACTATCGAGGCTAAAGGCAAAACCACCTAAAGAAATGATCTGCCTTGGT
AACCGTGCGTGGTGCACCTATATGCAGAGTCTTCGGGCGACCGTGGCTCAGACTACAAGCCTAGACATCGTCAAGCGTCA
TAAGCGTATCCTCGGTCTCATTCTCCCCTACGTCGCTGACGTGAATGTTGAAGATGCAGACGCGAATGTCGCTTGGGGTG
GCTTCTTTGGGGAGATTTTTCGTATCAACGAAGTATCACAGAGCTCAATCAACGGTATGCGCATGCAAATGATTGCTGAG
ATTTTGGTCCATGGAGCTAATCCCAACGCGCCATACATTGGTACTACCACCTGGTTGGACTTACACAACTACCTATTCAT
CACTCGTGGATGGGATATCGAGTCGGACAAGAAAAGCAATCACATGGAGCGTCTTGCAAACATAACTGAGATGTTTCTAA
GACATGGTGCCGACACCAGGTTTGTTCTACTCACTGAGGATCGAATACGGTCTGTGTTCCCCCCACACCTATCGGTTTCT
ATCTGCAACTTGCTCCAAATGATGCCGAAGCCTTATATTACGTGGGGTGCTTATTTCTGGGGACTTAAGAGGTATTGGAT
AATATGAGCTTCATTCCGTGATGAAAGTATAAGATTAAAATATTAGGCAGGCGTTTCTGAGTAGCCAACCGAGCAAGATA
TATACATGGAGGTTTTGGCAATCAATTTGATTAAAAATAGAGCTGGCACACAAACCAACAGCGACTTCCTGGAACTTAAA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62