GenePrediction:GLEAN_3174 Details

Name: GLEAN_3174
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:748701..751638 (+ strand)
Length: 2938
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:748701..749834 (+ strand)
Length: 1134
Type: CDS
Source: GLEAN
Position: GCSC_161:749886..749933 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_161:749999..750208 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_161:750275..750358 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_161:750425..750644 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_161:750707..751638 (+ strand)
Length: 932
>GLEAN_3174 class=GenePrediction position=GCSC_161:748701..751638 (+ strand)
ATGGCAGAGGGCCACCATCACAATCTGCACCTGCACAGCCATCACCATGATGCCGGCGACAGCGATGAAGACAACGGCGA
GCAGGTGCCGAACAGCGAGGGCGTCCATAACCCCTATGCGTCGGCCAACCGCTGGCGACACCAGGAGTCTCCCGCATTTG
CGCGCCATGCTGCCGCGCCACGCGACGACGAGGACCCGCGCGGCAACACCAGCGATCTACGCGATTTTCTGAACGCCTCG
CGCGTGACACCGACCGACACAGCTGCAGGTGCTGCCGGTGTTGCTAGCAGCGCCAGCAGCTATCGCAACAGAAGCGACTC
TGCGGCGGGTGGAGGCAAATTCACGCCCATTGTGGTGCCGACAGCGGCAGCCGACGTGGAAAGCAGAAGCGGGAGCGCAG
GTCAGTCTGCCGCGGGGGGCAGCAATGAGATTGTCGTGGGGCCACTGCTCAACTACAGGCGTACCGAGGGCGACAATTGG
ATCGGCAGCGTGCTGGTGGTGACGCGCGGTGGTGGCAAGACGCTGCCGGCGACATCACCGACGCTAGTATTTGGCCCAGC
CGATGGGACGGGCGAAGCGACAGCCGAGGCGGGCGGCCAGAAGGAGATGCGCGGCATCTGCCTCTACTCGGACCCGCGCG
CCACATTCTGGCGCTTCAATCTGTCGGTGCGACTGCGCGCAACCGAGACGCGGTGGCAGTACAGCCTGCCGGGACTGCAA
TTTGCCAGCGCGACGAAGCCGAAAACGAGCGTGTTCTCGGTACCGGCGGCCAGCGAGTCGATGCGCATCCTCTTCTTCTC
GTGCAACGGCTTCAGCGTTGGCACGGACGAAGAGGCCTGGAGCGGCCCGGCGCTGTGGAACGACGTGTTGCGGCACCATA
GCAAGGCGGCATTCCACGTGATGATCGGTGGCGGCGACCAGATCTACAACGACGGGATCCGCGTCAACGGGCCGCTGCAT
GAGTGGACGGCCATTGGTAACCCCAAGAAGCGACGCGAGTTCCTGTTTCCTGAGAGCCTGCGCAAGAAGTGCGACGATTA
CTACCTCAACAACTACATCCGCTGGTACTCGACAGAACCGTTCGCCACGGCCAACGGCCAGATTGCCCAGCTGAACATCT
GGGACGACCATGACGTGTGTTCAGCTTGTCTCTCACTCCTACTTCCTTATGCTGACACCAACCAGATTATTGATGGCTTT
GGCTCCTATGTGAACGAGTTCATGAAGTGTGACGTAAGCAGCCATATACGCCACATTTCAGCCACATTTCAGCTGTCCCC
TCTGACAAGGCCTGACAGGTATTCCGGGGCATTGGCGGGTCCGCCCATAAGTACTACATGCTGTTCCAGCACCATCTGCC
GCCACCGCCATCGACGTTCACCTCAGATGCACCTCATGTGGGAGTACCACAGGCCAATGGCCACGCGGAAGACCCGGCAC
AGCTGGTCGACACGTATGTGGCGCCTGCGATGATTGAGTCCGGCTACATTATCGGATCGAAGCCAGGGGTAAGTAGAAGC
AGGCGAGAAGACAAAGAGCCGGTACAGGGACAAGGGCAGAACTGACATGCGCAGCCGTATGTGGCGGAGCACTCGCACAA
CATGTATGCGAAGCTGGGAGCTCGGATGGCCTTCCTGGGCATTGATGCGCGAACCGAGGTAAGACAGACGGAGATACTGG
TGGTCTTGGCCTGATATCTGGCTGACTGACACGCACACGCACAGCGAACTCGGCACCAGGTCAACTACCCAGAGACGTAC
GACCAGATCTTCGACCGGGTCGACAAGGAGTTCAAGGCAGCGGCAGCGGCAGGCGAGCCGGTGCGCCATCTGATTCTGCT
GCTGGGGATTCCGATTGCGTATCCGCGCCTGACCTGGCTGGAGAACGTGTTCAACAGCCCCGTGATGGGTCCGATGAAGT
TTATGAACCGTCGATTTGGCTTTGGTACGTGGATGATCAGAAGGACAGAAGGAAGACGGATGCGAAGCAGTTGTGCTGAC
AGACAGGCGGTGGTTTCTTCAACTACTTTGACGGCAGCGTGGACCTGTTGGACGACCTGGACGACCACTACACGGCGCGG
ACGCACAAGAAGGAGCGCAGCGGGTTTGTGGAGCGGCTGCAGACGGTGAGCGCGGCGCACTCGGTGCGGATCACGATTCT
AGGCGGCGACGTGCACCTGGCGGCGCTGGGCCGGTTTTACTCGAACCCGTCGCTGCGGGTGGCAGCCGAGCAGGACCACC
GGTTCATGATCAACGTGGTGTCGTCGGCGATCACGAACAAGCCACCGCCGGCAGCGATAGCGAATCTGCTGGCACGGCGC
AACAAGATCCACCACCTGAACGAGGCCACGGACGAGACCCTGTTCCGGCTCTTTGACAAGGACCCCGGAACGGCCACGCG
GACGGCCTCACACAACCAGGTGACCATGCCGAGCCGCAACTTTGCCATCATCACGGAAAACTCGCCGCACAACGAGGGGG
TGGCCGAGGCCGAAACGGCCAACAGCAACTGGGTGCCCGGAGGCCGGGGCAGCTCGCCATCGACGATGCCGGCCAACGGA
ACCAATGCGACTAATGCGACCAACGCGACCAACGGCGACAACTCGTCCGTTCCGCCCGGCTCGAGCGCTGGCTACAGCGC
GTCGGCCACCAGCACACGGTCACGGCCAGCTACACGGTCGGCGTCTGGTCGCCACGGCAATGGACACCGGCCGCTGCACG
CAGGCGAGGAGGGCGCCGGGACCAAACACCGGGCCGCCGGGCCGCTGCATGGCCGGCTCAACGACGGCAGTCTCGACGTC
AGCATTCGGGTCGAGATGGACCAGCACGACCGCGAGGGCCACACGGAGGCGTACGGGCTCTCGATCCCAGCGTTGGACTG
CACGGTGCCACCAGTGCCGGCGATCCCGTCACGGTTCCGGGATGGCAGCGGGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62