GenePrediction:GLEAN_3175 Details

Name: GLEAN_3175
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:755660..758393 (+ strand)
Length: 2734
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:755660..755777 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_161:755950..756033 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_161:756899..757320 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_161:757404..757537 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_161:757617..757735 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_161:757795..758393 (+ strand)
Length: 599
>GLEAN_3175 class=GenePrediction position=GCSC_161:755660..758393 (+ strand)
ATGGCCGAAGAGGGAGAGGAGATGGCGCACACAGGCGACGATAACCGCTCGGCTGCTCTCTCTTGCGAATGCAGAGACAG
GGATTTGGCCCAACTGCACGAGTACGAAAATGTATTATGTAGGCAGCCGGACTACGGCTCCGCGTTGCATTGCAGCTCGC
CTGTATCCTCCGTTTCCGTCCCCACGTCTCGTCTTGTCCCCATTTCTCTCGTTTTTTCTCTTTTCCTCTTGCTCAAGAAA
GACCCTTGTCAGCGCACCCCCCTCCCCCAGAAGAACCACTCTGCCTGCAGTCCTCCACACCCTCCTCGCCGTCCTCTCTG
CGGCCACGCTTGCGCTTCCTCGCTTGCCCGAAGGCCCGGACCAGTGCAACACAAGTCTGTCTTACAAGGGTGGGCGGAAG
GGCCAATCCTCTCGTGCTAATGCATGCTTTCTTCACATCCCAGCGGAACAGAGCTCAAATAGGCCCCATCTCCGTCAGAC
TCTTCTGACGACAGCAAAGGTGAGATAACCTGCGTCGCTCGTGCAATAAGCAAGCCAAACCTTGGCGTGTCTCACTGGAC
AGCCCGACTCTTCAGAAAGTGGCCGGTTGCTCGCTCTAGTCTCCTTTTCCATCACACGGCAGGTCCTTTTTGTAGCCTTC
TCTTCTGCTTCCCCTCTCCTCCTCGCTTTAGCCCCTTGAGAACACTAAATTTGTACTTCGTATATGTGCAACATGAGACT
CGGCTATTGAACCAGGATCAATCGTTTGGATTTGCACCAGATATGCTGCCGTCGCTCATGTGGCCACCCTTCATCCCAGA
TCATGTATGTATGTACATGGTAGCGTTAGGCTGGTGGCGTATGACTTGGACCTTGTCGCCAGGCCACCCACCACTATAGG
CTGACATCTCTTGGCAAGAGATGCGGGAATGCCTCGGAGCTTTACGGAGTACTCAGTAGTACGAATAGGCAGCAGCTTTC
ACTACGAGTAGTGTTCACCTTCAGCCGCGGAGCTGTGAAGACGAAATTATGCCCTTACCACCTTGTTATAGTGATATCCT
TGTACAAGATATGCACTGACAGAGCAGACTCGCCTACGATCTGAAACCGCTTTACGCGACAACAGACGCGACGTCAGGCC
CACTTTTACCAACTGCGTCTTATCCCAGCATTTTTCAGGCCGTTGCCGCACTGCCTTGTCAGAAGCCACTACTACGCACG
ACGGCCCTGCGCGCGGCCACTGACACGATCGCGCAACAGCAACACCCAGCTACCCGACCAGCGTACACGTTCGTGCAGCT
ATCCGCAGAGAGACAGGCAAGGCTCCGAGGCGGTGGCCATTGGCGATCGACCAACACTTCCTTGTCGGTGTCGCACGTGA
GAAGAAGGAGGACGAAGCCGGGACAAGCACGAGCAGCATGCCACCGCGTAAGAGCGACGGCGGCGGCGCGGCGGCGGCGG
TGACAGCCGCAGCAGCAGCAGACGGGCTCCGGCCACCGGCCACCACGCCGCCACCACAACACCAACGAGCACCAGCTCCG
TCCACCCCGTCTTCCGATCCGGCAGCTCCGTTTTCTACCGATGCCGGCGACGACGCAAAGGATCCATCCACGACGGCCGC
ATCAGCCGAAAAGGACAAGGAGCGGCGAGAGTCGCGCGGTAACGACGCAATTACGATCGAGGTACAGCCCATCCCATGTC
TTCGCTCCCTACTTTCTTGCTTCTTGCTTCTTGCTTCCCTGCTGACCAGGCCGCACGCACCTAGGACCTCAGCCTGCCAC
GATCCATCATCACCCGTTTGGCCAAGGGCGTCCTGCCTCCCAATACGTCGATTCAGGGCAACGCCGTCACTGCCGTAACC
AAGAGCGCCACTGTCTTCATCAGCCACTTGGCCAATGCGTGCGTTCTTACCAAAGCCTTTCCCGCCTGTTTGTGCCGTCA
GAGACTGACGTTTCGGGACATTCTCGTCTCCCTGCAGTGCCAACGTCATCACGACCAATGCCGGCAAGAAGACGATCATG
CCGGCCGATGTCCTTGCCGCACTCGACGACATTGAGTTTGGCTTTCTGCGGCCCCAGCTCGAGGCCGAGTTTGCCAGTCA
GTGTCTTCCTTTCTGCCTTTCATCTTTCTTCTTGCTCACACCCGCCTACCAACAGAGTTTAGCCACATCCAGACCTCCAA
GCGGTCCGATTACCGTAAGCGGGTAGCTGCGGCCAAAAAGGCCACCACAGATGGCGACGGAGATGGTGATGGCAATGGTG
ACGGCGATGGCGACAGCACGATTCCTGGCGCAAATGCATCGTTTGCCTCTGCCGTGGCCCACGACGAGAACGATGCAGAA
GCCGGTCGGCCGACGGCAGCCAAGGGCAGCAGCAGCAAGGCCGCCGCCAAGGGCACAGCTTCATCCAAGGCGAGATCCGC
AGGGGAATCCTCTGCAACAACAGCAGCAGCAACATCGGATAGTGCGCCGCCGCTGGCCAAGAAGGCCAAGAGGGGATCGT
CGCAAGGCAAGGGCAGTGCCAAAGCCGTAGACGACGAGATGGGTTCGGGCGACGCATCTGATGCCGAAGACGAAGACGCT
GTCATAGACGAGGACGAGGGGCCAGAAGAAGACGCCGAGGAGGATGAGGAGGAAAACGAGGATGAAGAGGATGACGAAGA
GGACGAGGAGCAGGGGCCAGACGAGGACACCTTAGAGGACCGCGATAATGCGCCGGACGAGGACGAGGCCGTCGACAGCG
ATGGCAGTGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62