GenePrediction:GLEAN_3179 Details

Name: GLEAN_3179
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:784474..786635 (+ strand)
Length: 2162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:784474..784706 (+ strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_161:784788..784801 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_161:784885..785137 (+ strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_161:785200..785268 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_161:785347..785601 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_161:785666..786220 (+ strand)
Length: 555
Type: CDS
Source: GLEAN
Position: GCSC_161:786275..786635 (+ strand)
Length: 361
>GLEAN_3179 class=GenePrediction position=GCSC_161:784474..786635 (+ strand)
ATGCCGTCCGAGCAGCACCCCCCCAACTACGTGCCTCTTGGCAAGCAGCCTGGATACAAGCCTCTGCGCAAGATCCGTCT
GGTTGCCATTGGCGCTGGGTTCGGCGGTCTGAGCCTTGCCCACAAGGTCCAACATGCCATGAAGCTGGAGGACGAGATCG
ATTTGGTCATCTACGACCGCAATGACGGCATTGGCGGCACGTGGTTCGAGAACAGCTACCCTGGAGCTGCATGGTATGTT
TCCCAGTTCTTGCGCAGTACTCCGTACTGGTTCTGTTACGCGTAGCTTTTACGTTTTTGCTGACGATCTTGCAGTGATGT
TCCTGCACGTGAGTGGATTTGTGCCGTCCCATTGTGAATTTTTAATGGACAAATGGAGAGCTCGTGTTTGCGTTTCATGC
TGATCCCATAGATGCTTACGTGTTTCCATTTGAACCAAACCCAAACTGGTCGTCCTTTTATGCCGGCCAGCCAGAAATCC
TGGCTTACATGCAACACACGGTGAAGAAGTGGAATTTGCTCAAGCACGTCCAGCTGAACACGGAGATTGTGGAGGCTGTC
TGGAATGAATTTGACGGCCAGTGGAACCTCAAGATCCGCACTGTGGGAGGAGAGGTTCGCCAGGACTATGCCGACGTTCT
TGTGAACTGCACTGGCTTCCTCAAGTATGTGAAACTGTGAGACTTTAGAGAGACGCAAGCTAACCCTTTTTCTCTTTGAT
TCACAGCCACTGGAAGTGGCCCAACATCGAGGGCCTGCACGATTTCAAGGGCAAACTGGTGCATAGCGCACGCTGGTGAG
TGTCTTCTCTACAAATGGCTCCTGTGCAGTCGTTGTCTCCGTTCTTTGCTAATCGCCCATCCGTCTGCACCAGGGACAAT
GCCGAGTACAAGGACAAGCGTGTTGCCGTCATCGGCAACGGTGCATCGGGCATCCAGATCACGCGTTCGATTGCGCCCGA
TGTCAAGAGCATGACCGTTTACATGCGCAGTCCCACATACATCTCGACCAACTTCCTCGAGGAGCTGACCCCCGAGGGTG
GCCAGTTCTCCTATTCGGAGGAGCAGAAGAAGAAATGGAGAGAGGATCCCAAAGCCTTTTTCGACTATCTTCGCGAGGTG
GAGTTGCAGTACGTTCTTTTCACTGTCCCCTCTCCTTTAATGAAAGCATTCGTCCGAAACCTAACCTTCCAGTCTGAACC
GCTACATCTTTGCGCTGGTCAACGGCCACCCCGCCCAGGAAATGGTCAGCAAGAGGATCAAGGAGCGTATGCACGAGGCG
CTGAAGAACGCGCCCGAGCTGGAGAAGCAGCTGACGCCGTCCTGGGTTGTGGGCTGCCGCCGTCTCACGCCCGGCGACGG
GTACCTTGAAGCCCTGCAGCAGGACAATGTGCGGACGGAGTGGACGTCAATCGACCGGTTCACCGAGAAGGGCATCCTGC
TCAAGCCCGAGGCAGAGGGCGAGGCCGGCCGCGAAGAAGAGTTCGACTTGATTGTGTGCGCGACCGGCTTCGACACCAGC
TTCATCCCCAACTGGAAGCAGGTCGGACGCAACGGTAGCACCATGGACGAGATGTGGAAGGAAGATCCAGAGGCACTCTG
GAGTGTGCACGTGATCGACCAACCGAACTACTTTGTCATCAACGGTCCCAACATTCCCATCTCGCACGGAACGGTGTTGA
CTATGATGGGCTGGGTTTGTGACCACATTCTCCGGTGGACGAAGAAGATCAACTGCCAGGACATTCAGTACGTCCTATGT
ACCCCTTCTCCGTGATTTGTTCTGTCTGCTAACAGCCACAGCTCTGTCGTGCCCAAGCCGGAATCTGTGGCCGACTACAA
CGAGTACCAGCAAGAGTTCCTGCGACACACGTCCTTTGCTGACAAGTGCCGGGCATGGTACAAGAACGACCGGTCTGAGG
GCCGGCTGACAGGCGTCTACGGTGGCACCATGATGCACTTTAAGGAGGGGCTGGAGACACTGGGCGCCGAGCACTTTGAC
GTGAAGTGGCGGTCGGCAAACCGCTTCAGCTACCTCGGCAACGGCACTGCTGAGTGCGACGAGAATGGTGCAGGAGACGT
CGCTCCGTACTTCACCTGGGAGTACTTCCAGAAGGTTTACGGTGGCTTTACCGAAACCCTGCCGGTTGTAGCAAAGGAAT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62