GenePrediction:GLEAN_317 Details

Name: GLEAN_317
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:993231..994995 (+ strand)
Length: 1765
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:993231..993610 (+ strand)
Length: 380
Type: CDS
Source: GLEAN
Position: GCSC_167:993687..993818 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_167:993879..994995 (+ strand)
Length: 1117
>GLEAN_317 class=GenePrediction position=GCSC_167:993231..994995 (+ strand)
ATGTCGACGACGCCAGGTCGCCTGGGCTTGCATAGACGCAGCTTTTCCAGGAGCAGCCTCAGCGTGTCTGAGCGGCAGAT
TCTCCTGGGAACACCGCTGCGACCATCACTCTCCTCTCGGCCTTCGACTCCGCCGTCACCCATCCGGCTCTTCTCCCAGC
AGCAGGGCCCGCGGCGATCACGCTTCTCGACCCGTCTCCGCAACGTGCTGAGAAAATCGAAATTCCGCTGGCACCGGATA
CCTGTCGGGCTGGGCATTGGCTTCCTGGGCATCGTCCAATTCTACAAGGTGTCCCGACGCAATGCCGAGAAGGACGAGCG
GGACCAGGACGCCGGTCCTGCGCCTGCGAAACGGCCACGTATAAGGCCAGAAGGGCCTTGGTAAGCGGAAAGAGAAGAGC
GGCGGAAGAACGGCGGAAGAACGGTGGAAGAAGGACCGGCAGCTAACAAGACACAGGCAGGTGCGGGTAATGTCTACGCT
GCCGCTCAAGGCACTGTCCCGTCTCTGGGGCCGCTTCAACGAGCTCACAGTGCCATACTATCTGCGGGTGCCAGGGTTCA
AGCTCTACAGCTATGTGTTTGGAGTTAAGTAAGTTTGAGAGAGAGAGAGAGAGAGAGAGAGAGGAAAAGCCCGTCTAACA
GCCGACAGCCTGAGCGAAATCGAGGAGGAGGACCTGCACAAGTTTCCGAATCTGGCGGCATTCTTCTACCGCACCCTTAA
GGATGGAATGCGGCCGTTGCATCCGAGCCACAACGCGCTGTTGTCGCCATCAGACGGGCGAATCTTGCAGTTCGGCACGA
TTGAGAGCGGCGACATTGAGCAGGTCAAGGGCATGACATACAGTCTGGACGCGCTGCTGGGCAAGCATACGCCGACGCCG
AGCATCGCGAACGGACAGTCAAGCGCGAGCCGGAAGAGCGCGGCGGCCGCACCGACGGCAAGCAGCCACGGCGAGACGTC
GGTGCACCCGGACGAGGAGTTTGCGCGGGTCAACGGGATCCCCTACACGCTGCCGGAGTTGCTGTCGGGCGCGCCGATGG
CATCACAGCAGCCGAGCAGCGGACAAGACGAAGTGGAAGACCAGTCGACCGGGGCAGCCGCGACGTCAGCCGTTTCGGAG
GTGCAGGCCGATCTCGACGTGCCGTGGCACAAGCAGCTGCTGGCACGCGACAGTCGGACGACGCTCTACTACGCCGTCAT
CTATCTGGCGCCCGGCGACTACCACCGCTTCCACTCGCCGACCAACTGGGTGGTCGAGCGGCGACGCCACTTTGCCGGCG
AGCTCTACAGCGTGTCACCGTATCTGCAGCGCACGCTGCCCGGCCTGTTCACGCTCAACGAGCGGGTCGTACTGCTCGGC
CGCTGGCGCTGGGGCTTCTTCAGCTACGTTCCCGTCGGCGCCACCAACGTCGGATCCATCGTCGTCAACTTTGATCGCGA
GCTGCGCACCAACAGCCTGACGACCGATACCGCTGCCGATCGAGCTGCCGAGGACGCCGCCCGTCGTGGCGAGGTCTATG
CCGGCTTCTCCGAGGCCACCTATGCGGCCGCTAGCCCTATCCTGCACGGCTATGCCTTGCGGCGCGGCGAGGAGATGGGC
GGCTTCCAGCTTGGCAGCACCGTCGTGCTCGTCTTCGAAGCCCCCGTCCAGACTACCGCCGATAGCGCCACTGCTACCGC
GCCCGCCCATGCCGGCTGGCGTTGGGCCGTCGAGAAGGGCCAGACGGTCAAGATGGGCCAGGCTCTCGGCTTTGTCGACG
AGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62