GenePrediction:GLEAN_3180 Details

Name: GLEAN_3180
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:789067..790689 (+ strand)
Length: 1623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:789067..789146 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_161:789246..789813 (+ strand)
Length: 568
Type: CDS
Source: GLEAN
Position: GCSC_161:789892..790326 (+ strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_161:790384..790493 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_161:790659..790689 (+ strand)
Length: 31
>GLEAN_3180 class=GenePrediction position=GCSC_161:789067..790689 (+ strand)
ATGCAGCACAATCCTGATAGCGATGACGATAATGGAAGCATCGAAGATACCGTTGTTATTGGAATAGACTTTGGAACAAC
GTGAGTCTTCATATGACCGTAACAAATTCGGAAAACGAGTAGACTGATGAGAACTAGATATTCCGGCGTAGCATGGGCAA
CAGCGGCTGATTTTGACAGCGGCCAGATCAACCTCATCACCGCTTGGCCGGGTACAGGTAGAGATGAAGGAAAGGTACCG
ACTGAGTTACTGTACAAAAATGGCGAAGTCCTATGGGGCTACGAGATCCCTCCGGATGCAAAGTCCGCCCGTTGGTTCAA
GCTACTGCTTCTCAGGGATGAGGATCTTTCAGCAGAGCTCCGCAAGTCCGAGTACATTCAGCACGGCCGCGACATGCTCT
CGGAGATGGGCAAGTCGGCCATCGACGTCACAGCTGACTATCTCCGGATGTTGTCACAGCACACCCTGGAGACCATCCGG
AAGTCCCGCGGCGAGTCCGTGGTCGATGCTCTGCGTTTTCATATCGTCATTACCGTTCCGGCTATCTGGAAGGACTATGC
CAGACAGTCCATGAAGGAGGCCGTCCAAAAGGCGGGCCTTTTGAAGCCCCGCGCAGCCGGGCCGACTACGTTAGCTTTTT
CGCCTGAGCCGGGAGGGCGGGCTGCTCTGGCGACTCTGTGCGAACCCGGAAGAAAAACCGAAAAAGATGATGTTTTCATC
ATATGTGATGCTGGCGGCGGCACGGTGGTAAGAGCCATCCAGGCGTGAATGGCCCTAGGAAATTATAATATCTGGATGTC
GGCACTTACTATCCCGTGACTACAGGACCTCATCAGTTACAAAATTGATAGCACCGGCCCAATCGCCATGCACGAAGCAG
TAGAGGGGTCAGGCGATCTCTGTGGAGGGATTTTCATTGACGAGGCCTTCGAAAAACTCTGCAAGTCTCGTCTTGGGAAC
AGGTGGAATAATTTGAGCACAGCAGGGATCAGGGAAATCATAACAGGAGAGTGGGAGACCGCTATAAAGCCGCAATACAA
ACCAAAGGCGAGGAAGAGCGAGTACATCGTTCGAATTCCGGCTGAGGCTTTTCGTCATTCCAGCCTCGATGACCTCAGTA
AAGAACCTATCATCAAAAACGGAAGGGTTCATTTCACCGGGAAGCACATCCAGGGGACATTCACTGATTCCTTTTCTCGC
ATTGACAGACTTATTGATGACCAGGTTGATATGGCAACTGGAGCAGGATTGAACACCACAGTAAGCACCGACAGCCCTGT
CAAAAATTCTCAACGGCTCAATACTAATTGAGCGCAGGGGATCATCCTTGTGGGTGGACTTGGCGCTAGTCCCTATCTCT
ACATGCACCTCAAGAAAAAATACACTGCGGCTGGTATTGATGTTCTGCAGTCGACGGGGATCAACCCGTATGTCTCACGT
CAAGTGATCAACGACGCTCACCGTTTTTACGCTAACGCTACTCGGCAGGCGAACAGCAATCTGTCGCGGCGCCGTCTACA
AAGGATTCCTCGAGCCTATTGTTACTGGGGATAGCCAAGTGAAGTATATCGACCATCTGATTGATATTCCAGTCAGGGTG
ACCTCAACGGTGTCAAGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62