GenePrediction:GLEAN_3181 Details

Name: GLEAN_3181
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:792565..793158 (+ strand)
Length: 594
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:792565..792572 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_161:792723..793158 (+ strand)
Length: 436
>GLEAN_3181 class=GenePrediction position=GCSC_161:792565..793158 (+ strand)
ATGGAGAGGTGAAAGTCGTGGTGGAAGGGCTCGTGCAGAGCACCCAGAAGCCATTGGCAGAAGCCTTGTCAGACCACGAA
AGTCGTATCACGGCTTTGAAGAATATATTTCAAGGTGGTGGCGGCGGTGGCGGCGGAGACGACGGCAACGAGGGGAAGGG
TGGAAGTGACCCCCGGGACTGGAGATAGTGGCAGCCCTGGCACTGGAACTGGCACTGCAGTTGACAACGACGGCACCAGA
AGAAAATCAAGAGGAAGGGCACCGGCTGCAGCCAATGATGGGCTGCAGTCAGAGCCAGCAGTTGCAGAAGATTCAAAGGC
ACCTGTAGCAAAGACGACAGCGGCAAGGGACGCGGTGACACTTTTTGGACCTGCGACACCGGCGGCATACGATGGCGACA
GAAAGGGTGATGGCAACACCCGGACTGTTGGCCATAGCAGCGACCACGACGGCATTAAGAGTAGTAGCAACATTAGTACT
ACTCCAAAGGTTATGCTCGTCCGCCGAAGAAGAGTATATGCCAAGAACGAGAAGGGCATCCTTACAGTCAGCCAGCGTCT
TCTCATGCGCGACGGTGGCGATGGTAGTTATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62