GenePrediction:GLEAN_3182 Details

Name: GLEAN_3182
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:793411..793944 (+ strand)
Length: 534
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:793411..793458 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_161:793492..793944 (+ strand)
Length: 453
>GLEAN_3182 class=GenePrediction position=GCSC_161:793411..793944 (+ strand)
ATGCTGCGATCTCAAAGATTGAAGTTTTGTCGGAAAAACATATCTTATGTGCGATAAGACGAAACTGAACAGTGCGACTA
GAATTTTGGTATTGCCCTAGAGGCGGAGCAAGAGGCCAACGACAATGCCGACGACAATGCCGACAACAACCCAGACGCAG
AGGCAGAGGAAGACGAGACAGAAGAAAAAGTCTGGTACGAAAAGGGCAAACTGCTGGAGCCACTCAACAAAGTGGCCTTT
AGCACGATTGTCTTTGACGAATGCCAGTACGTGCGGCGTCCACTCTCGACATACGGCTGGCTGGCCCGCCTGCTGCAAGC
CGATGCTAAGATCCTTGCGTCCGCGACACCATTCCTCAATATCATTCAGGACATCTGGGGGGCTCTGACGATCCTGACCG
AACACGCGAAAATCGGCCGCTGCTTTTATCTCGTGTCCTTAATTGCTGTCCAGTTACGCCTCCTTTACACATTCGTCACC
TATCATTGTTTAGGGGAGTTCCTCCGCCAGGATTTAGACAATTACCTAAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62