GenePrediction:GLEAN_3183 Details

Name: GLEAN_3183
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:796192..797771 (+ strand)
Length: 1580
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:796192..796773 (+ strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_161:796952..797358 (+ strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_161:797495..797771 (+ strand)
Length: 277
>GLEAN_3183 class=GenePrediction position=GCSC_161:796192..797771 (+ strand)
ATGCAATACGTCCAAAATCTGTCGCTATTTACATCCGACCAAGATGTATTGGACAAGAACCAGGCGCTATTCGTCAAGGC
GATTCGGGGCGGGAATCTATTCTTCCTGCAGAGGCGCCTGATAACGTCAGATGACCCGGCTTCCAAGCTGCCGCCCGACT
CAGTCGCCATGGCCGTGCTGCACGGACATGCCGATGTCGTTGGCTATCTCCTGGACATAGGCATGTCTGTCGAGAAGGAG
GGCCCCTTTGGACCGCCACTACGAACGGCCAGCCTGACGAATCAGTTAGCCATTGCTGAGCTGTTGGTTAACCGCGGTGC
GAGTGTCAATGCAGGCGGACGTCTGGGCGATGCCTTGTACGTGGCTGCCATGAAAGGGCACACGTCGATCGCGCGGCTAC
TCCTTGACCATGGCGCCAGTGCCAGACAGGAAGGGGCCTTCTATGGCAACGCCCTACAAGCCGCGGCCTACTTTGGTCAT
AAGCAAATTGTGGAACTTTTGCTCGCCTCTGAGGTGATAAGCCACTCACGAAACCTCGTCCAAGGTGCATTTTACGTTGC
TGCCGAGGGTGGCCATGAGAATGTGCTCCAGTGCCTAATTGAGAAGGGCTACGATTCTCACTACAGAAGCCTCCTGATTT
GAACCCAGTCTCCACCATGCTCGCAAGTGCGCGAGTAGTATGCGATCATTTGATGAACAACCCGGCTGGAATGATCTACT
CCTTGATTATCCACGCCTTGATCAACATTCTCTTGACCAGTCTGGCCGGAACGACAGCGACAAAAGTTGGCCGGAGCACG
AAGTCGATTTTGCGACTATTTTCGCGGCAGCTTCCACGACCCGACTGACCAAGCTTCTCGAAGCAGACACGGCTGCTGCC
ACACCGTGGTACATGGACAGGAGGAGGGTCTCAAGTCCTTTAATAGCAGGCGCCCGTGCTGGACACACGGCCGTGGTCCA
ATTCTATCTTATGCAGAAGAAGGTGTTCAACTACGACTTTTTCCAGGCCGCAAACATTACCGCAAGAAACAATCACCTGA
ACGTCGTCCGGGTTTTGCTTAAGCATGCAGTGGCCAAACGCCTGATCAAAGATATTTTCGAGATTGTGTTTGAAGTGGCA
GAAACGACAGGGATTACCAAAACCACCGATTTTGCACTATACATCATGTCTTCCCAGGGCTTTTCCGATGAGACTTTGTG
TTGGCAGTACTCCGCCGACCCCCCCCCCCCCCCCCCCCCCCCTCCCCATAGATGAAGCCCGAGTTGTCTCGACCTTTATC
GATAGCTGTAAGTCCGGCGACAGGCGGACCATTCGCCGCATCTTGGCCTCTAAACATGCCATGCAACTCGACCGTGGCAC
ACTTAGCCGTGGGCTTCAACTCGCAGCCACCCATGACGCATTGACAATCAAGCACGCACAGCTCGACTCTCGCAGCATTG
CGGCGAAGCGGAGCACTTCTGACAATGATTTCGTGTCCACGGCTGCCACTGGCCACGTGCAAAATTTGAAACGCCTTGTC
GAAAACCAGCCGGAAATTTGCACCAACCCTGCCATCGCAGCCGAGGTCCTGCTTTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62