GenePrediction:GLEAN_3185 Details

Name: GLEAN_3185
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:800086..802116 (+ strand)
Length: 2031
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:800086..800500 (+ strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_161:800573..802116 (+ strand)
Length: 1544
>GLEAN_3185 class=GenePrediction position=GCSC_161:800086..802116 (+ strand)
ATGGACGACCTCCTTCTATCCGCGGCGTCCCCCTACGAGCCCTCGTCAACTCTGCCGTCGTCTCCGTTGACTGACCTCTC
TCGCACCCCGTCGCCGCCTTCGTCGCCCGTACGGTCTTCCCCCGATCCTCCAACGCGGTATCCTTCACCCAGCATGACCT
CTCAGTCCGGCTGCACAACACCACGGAAGACACATCACTACGACGCGCCTAGGGACCCCCACAGACGTGGTGATAGCCCC
CCCCCGGCCAAGAGAAGACGTGTACAGACACCCCGGCCGCGAATGACACGCCATGTCGATCTAGCAAACCCTACGCCAGA
ATCTGAAGAGGAATTGAGCCATCTTATCCAGGCTCTTCAGAAGAAGAAGAAGATTGTTGTCATTGCCGGAGCTGGAATCT
CCGTTTCTGCCGGAAGTGCGTCTCTCTGACTCTCCCGCCTGGGCTGGGCAGCTCACCTTTTCCTGTGCTAACACAATTTT
GCTCTAGTTCCTGACTTTCGGTCATCTACTGGCCTTTTCACAACTCTGCGAGAACAACATGGCATCCGAGCCTCTGGAAA
ACACCTGTTTGACGCTTCCGTTTACAAGCATGACGCTTCTACCTCTTCCTTCCACGCCATGGTTCGCGAACTCGCCCATC
TGACCCAAAAGGCCCGTCCGACATCTTTCCACCACATGCTGGCCTCTATTGCTACTGAGGGCCGATTGATGCGTCTGTAC
TCACAAAATATCGACGGCATCGACACGGCTTTGAAGCCTCTGAGCACCACAGTCCCACTGAATTCGAAAGGTCCTTGGCC
AGTCACCATCCAGCTGCACGGCGGTTTAGAGAAGATGGTGTGCTCCAAGTGTGGCAATCTCGAGTCGTTTGATGGCTCTC
GTTTCGACGGTCCTGAACCGCCGGAGTGCGACGAGTGTGCCGAAATAGACAAGCTGCGCACGTCGTTCGCCGGGAAACGC
AGCCACGGCATTGGTCGCCTCCGACCACGTATCGTTTTATACAACGAGTACAACCCAGACGAGGAGGCCATCGGCAACGT
GTCCAGGGCCGATCTGCGTCGTGGTCCCGATGCGGTGATTGTTGTCGGTACCAGCCTCAAAATCCCCGGTGTACGGCGCC
TTGTCAAAGAGCTGTGTCAAGTCACCCGAAGTCGCCGTGACGGAATGACGGCTTGGATCAATGTCGACAACGAGCCTCAG
GGTGCCGAGTTCAAGGAATGCTGGGACACTATTGTGCGTGGCAGTTGCGACGACATTGCCCGTCTCGCGAACCTGCGGCC
GTGGGACCAGCCCGACGATATTGGCAGTCCCAGCAAATGGCTGCTTGCTGGCTATGAAACCCATGCTGACAGCAAGCTGG
AGGTTGTTCTAGAGTCATCACCACTTAAGAAGTCCCAGAACATTCTCGGCAACCAAATAGTGAACGGCATCAAAGTGGAA
GAAAGCGCGGCAGAAGAGAAGGCAAAGAAGGCACACACTTCGTCACCTATTGAGTCCATCCCGACTCCGATCCCGAGCCC
GAAGCCAGCAAGAAAACGGCTTCCAGAGCAACGGAAAGCCAGCTCGGCACAACAAAGCCAGCTACCGTTTCAACAGATCA
GGAAGTCAGACAATGGGTTGATGGCAACAAAGGGGGTCGAGTCGAAAGAGGATACGAAACCCGCTGTGGAGTCTTTGGCA
AAAAGGAAAGGAGGGCTCAGCTCTTCGGCCAAGCCGCCGAAGAAACAACGGCAACCAAAGGGCAAGAAAGACGCCAAACC
CTCCAAAATCAACATCGCGACAAACTTCCGGAAGACGAAGAACACCTCGGACAGCACCCTGCTTTTTAAAACACGGAAAC
CTCTTCCTATTGGCAAGCCAAAGCAACAAGATGACGACATCAACCATGTGAAGTGGGATGGCCTTGGCTGTGTGGTGGCG
CCGGACGCCCCAACGGTTTCCCGGCCGACATCGCCAACTGAACTACAAACGGCAGGGCTGACAATCTCGCCGAAATCCAA
ACCTCATGGCATGGCGCAGTTCATTGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62