GenePrediction:GLEAN_3186 Details

Name: GLEAN_3186
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:802925..807430 (+ strand)
Length: 4506
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:802925..803121 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_161:803181..803546 (+ strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_161:803669..803862 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_161:803918..804354 (+ strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_161:804420..804639 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_161:804704..804823 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_161:804883..804996 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_161:805049..805330 (+ strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_161:805389..806348 (+ strand)
Length: 960
Type: CDS
Source: GLEAN
Position: GCSC_161:806485..806516 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_161:806654..806696 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_161:806760..807430 (+ strand)
Length: 671
>GLEAN_3186 class=GenePrediction position=GCSC_161:802925..807430 (+ strand)
ATGGCGACTGACTCCATTCCGCTGATGCTGGACGGCGCCATGGGAGGCATGGCGGCCTCGATGCCGGTGGATCTCGAGGT
CGAAGACGTCGAGCTGTTTGGAGACCCGGTTGTCGACCTCTCCATGCCGACACATGCTCCACCGACGAAGCAGCTGCGGA
AGAGGGTCGACGAGATGCGCATAAACGGGTGCTGCCAGTAAGTCCTCGTCCGTAGCCCAGCCGCGCTTCCATGTCCAGCT
TGTTGACTATTTCTAGGAAGATTGCGTGGTCGCGGCAAGGCACGATTGCCTCGATTGCCCCTGACGGCCAGGCAATCGAG
CTGAGGTACCTGCGGACAAATCCTCTGGACGGCTCCTGGGGCCTGAGCGAGCCCACGCCGTGCTCGCAGTTCGGGACGAG
TCCTCAGTTTTCTGGCGGCCCTGTCGTCCACCTGGCCTGGGCTGCTACCGGCAGTCCCGAGCTTGCCGTGATCGATGCTG
CCGGCCGTGTCAGCATCCTCACGTTTTCTATGACCTTGAACCGGCCGTACTCGCTGCGGCAGTGGGACGACGATCCGATC
GACGACCTGCACGCCATCGTCGGCACCTACTGGCTGCCGCTCATCCCGCAGAAACAAAGCAGGTAGGATTGAGTGATGTT
TGGGTCGGGTTTCGGTTCTTGGAAACGCCGCAACTGACGATGCTCTAGTATAATGTCACGCACGGTCCGGCGATACGGGA
TGAGAATGGCTACCGCTATGACAGCACGTTTGTCCCAGCCTTTGGACCTTATCATCCCAACCCGGCTAAGAGCGCGCTGT
TGTGCGTGACAACCAGCTGCGTGCTGAAGCTGTTCTTCTCGCAGAACAATAACAAGGTTCAAGACACCAGCCTCGAGCTC
GAGAGCGCCACCTCCTCAGACGATCTGGCCACGCATGCCTCTATATGCTCCGAAAAGGGTGCGCGACAGCTGTTCCAATG
CTTGCCATGCGATTCTGTGCTGACCGTTCGCAGGAGGCATGTTGCTGATCGCTCTGGTGACCGCATCCAGACAACTCAAG
GTTGTGCGGGCGGCTATTCACTGGGCGTCATCACATCAGGACAAGCAGGTCCCGCCTCAGAGCATTCCTCTCAACCCCAC
CATGCAACATAGGTCTGCGGCCGTTACGACTTGGCTTCAGCATGGGGCAGGCGAGTCCCAGGTAGACATCTCCTCCGACC
AGATATCTCACTTGGAGATATTGCCATCTGCCTTGGTTTCGTCGAACTCCTTTGCTCCACCACTCGTGCTCACTGTGCGT
TCGTATCTGCCGTCGATGACTTCGCCGTTCCATGAGCAGGTCCAGAGTATTATCGACCGGTGGGAGTTGGTGGTGGACTC
GCCAGCACAGGCCCTTCATGTTGCTTTTGAGCAGGTGGGAACCAAAGCACCGCCGTCTGGAACTACGCAGGTAAGGCATA
ATGACCCCAGCGGGCGCTTCCGACGGGGACCTGTGAATCTGACTTTTTTTTGCAGCCCATCACACGACTACGGAAACTGG
AGCCGATCGTTCTGGACAAGGTTATCATTTCCATTCACATGATGCAGCTGGGAAAAGTGATCTGCATTGCCTTTAGTGAC
GGCACGGTCCAGTACCGAGACCGGTTGACGATGGAAGAAATCTACAACGAGACGAACCTGTCCAGAATCATGACATTGAG
CCAGGCGAACTTCCAGTTCGCGAACCCCACTCCATGTACGTCAAGCCGCTGTGGGTGTATCTCGATGCGGTCGATCGTGC
TAACACGTGGGGTGAACAGGTGTGGCGGTTGCCTTTTCTCCAACCAACTGCTCCTTTTCCCAGGTGTGCGAGGATGGCAA
GGTGAAGTGGAACAGCCTGAAGCACGTCGGGCCAGATCTTGGCCCCGGCCATAAGGATGGTAGGTTTGGAAGTTATAGGC
AGTCCGGACGACACAGAGTAAGCTAACGCAATGGACAGCCGAGTACGCGGCGGTTGTTGCAGGTCTGACGATAGCCGTGT
CGACGGCGTCGCTCAACCAAATGTCTTACGACGATGTGCTGGCTACGGCGCGCCAGTTTGTCGACAAGCCAAGTACGTCT
ACACGGCATGTGGCTGGTGTTGTGGGTGCTAACGCGGAATGCAGGATTTGCTTATGACTGGATGGTGGATGTTGTGCGGA
TGCTCAAGATCAACGTGGATTATTCAGAAGAGTCGCACCATGACCAGCTGATGAGAAACCACTCGTTGCAGCTGTGCCTC
AGCATACTAAACCATATGGGGTTCCGAGGAGAATACCAGCCCAGGACGTTCTGTGGCAAGTTTGCGATGCTGTCGCTGAA
CGTGCGGAATATTGTGATTTTGATCACGATTGCGAGTAACACTCCAAGCACATTCAAGGAGAAGCTCAACCCCCTCGACG
AGCCTGGTGAGTGTGAATGGGAGAAGAGGAGAGGAAAATAAAGGGAGGCTAACAGTGGATGCAGAGGTTGTGGACGCGCT
GGCTGGCTGTGCGAAATGGGCGCTGGATCTGCTGGCCTACATTGCCGATTGCATCTTCAATCTCCTAGACGACGCCAAGT
TCATGCAGATGCTCTCAACTTCGAGCTTCCAGGAGATGACGGCATACCTGCAGGAAAAGAATGAGGTGGCGCTACATCTG
CTGCTCTGCTCGTCGACGCGGGGGTTCCTGTCGGCGGCCTGTCGACGACTCGTGCACCTGGACGCGGTATCGACCAAGGC
GACACAGTATTACGAGCTGCAGAGCCAAATGGCAGCGAGCGGAAACGGGACAGAGCATGCAACCAGGCCGGTGCTCGTGC
CACTGAGCCTGGCCTACCAGAAGATGCAGCAGTACACATCGTCCAGCCTGGTCAAGGTGACCGAGTTTGACAAGTTGCTG
ATGGGCCTGGGCGAGGACATCCGGCAGACGTATCAGTCGCGAACGATGGGACAGGCCCAGGCCCAGGCCCAGGCCCAGGG
ACAGGGACAGGGACAAGGACAGGGACAGGGACAGGTGCAGGTGCAGCAGGACGCGAACATGAAGCGGCTGCAGGCACACT
GCGAGCTGGCGCTGCTGCTGGCGAACAATCCGCCGCAGTCATTCCAGCCGATGCTGAAAAAGTTCTTTAGCGAGAACGTG
CGGGCGTTCCGGGCGATGACAGATCCAGCGAAGCTGTACTTTGCCAACTACAGCATCCTCGAGGTTGAAGACGACGTGCG
GGCACTGCAGGCGAAGCGGGCGCGGCACTGCTACATTGACGTGTTCAAGCGCGTCGAGCTGGCCGGTCCGCCACGGCTCG
ACGGCGGCGGGACAAGCGAGCTGATGCCGCCAATGGGCATGCATGGCCCAACGGGTCTGTGGCGGCGATGTGCGCGGTGC
ACGGCCGTGATGGAGGACCTCTCGGGACACAAGCCCGGATACACGTTTGTGCTGTCGCAGCAGCGTAAGTGCAGCTGCGG
CGGTAGCTGGGGACTGCTTCCACGGGGGAGTTTGGTGGGTTGAGAGGAGAAAAAGTAGGGAGACAGAAGTTGAGGGTGAA
CTTGCCAAAGCTGAGAAGAGTGTTTCGTGTATATGCATAGATGCGTGGGAGAATTTGACAATCCGTATTAATGTATGGAC
TCCGCAAGCTTACGTACTCGAAGTGGGGATTACCTAATCCGGGCCGCCCGCCGCTCAGCGCGTGATAATCGCAAAGCCCC
GCTTCACCGAACTGTCCATCCGCCATCCGGTACTCCCTTTCCTGTACAGAGAAGCGGCACGATGTTCACGGGATTAGTAG
AAGAGATTGGAGGTGAGTGCAGAGGGGGGGGCGACGGGAAGAGTGAGCGAGTCTGACAGAACGTCCCCGGAACAGAGGTC
AGCGTGTTGAACCGGCAAGACGAGACGGGGGGCACGTCGCTGACGATTGCGCTGCCGGCGGGATCGGAGCTGCTGTCGGA
TGCGCACCTGGGCGACAGCATTGCGATCAACGGCTGCTGCCTGACGGTGACGGAGCTGGTGGCAGGCCGGACGGCCTTTG
TGGTGGGCGTGGCGCCGGAGACGTTGCGGGTGACCAATCTGGGCGATCTGGCTGTTGGAGGCCGCGTGAATCTCGAGCGG
GCTGTCCGAGCGGACACGCGCATGGGCGGCCACTTTGTGCAGGGCCATGTCGACACGGTGGCCCAGATCACGCGCGTGGC
GCCCGACGGCAACGCCCAGACGATGCGATTTTCGCTGCGCGATCGCGCCGCCCTGCAGCACATCGTCTACAAGGGCTTCA
TCGCCATCGACGGCACCTCGCTCACCGTCACTGCCGTCGACGATGCCGCCGGCTGGCTCGAGGTTATGCTCATCACATAC
ACGCAGTCGCGCGTTGCGCTGGCGGCCAAGCGCGAGGGCGACTCTGTCAACATCGAGGTCGACGTCCTCTCCAAGTACGC
CCAGAAGAATATTTCGGTCTACATCGACAGCCTCGTCGGCGGCTCGGGCATTGAATCCCTGGTACAGCGCAAGATTGAGA
GCGCCCTGGACGCGGCGAAGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62