GenePrediction:GLEAN_3187 Details

Name: GLEAN_3187
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:811844..814462 (+ strand)
Length: 2619
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:811844..812093 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_161:812156..814143 (+ strand)
Length: 1988
Type: CDS
Source: GLEAN
Position: GCSC_161:814214..814462 (+ strand)
Length: 249
>GLEAN_3187 class=GenePrediction position=GCSC_161:811844..814462 (+ strand)
ATGGCGTCCCTTCGCCATTGGGCGCTCTCCCTCTCGCTCGCCTCGGCGAGCCTGTTTTCATCCGGCTGCGTGGCTCAAGA
TGCAGACGAGCCTCTGCTCCACGCAGAGATCGGCCGCGCCAACAATCAAAGTTTGCTATGGGGCCCCTACCGACCGAACC
TCTACTTTGGCGTCCGTCCTCGGATACCCAAGAGCTTAATGGCCGGCCTTGTATGGGCGAGAGTCGACTCTTACACAGAA
GTACAGAATAGTGCGTGAACACTTGATTTCTGGGGCTACAGATTGAATAGCAAAAGGCTAATGTCGTTATAGCCTTCCGG
TATACATGCGAACAGAACGAGGGCATGGCCGGCTACGGCTGGGATGAGTACGATGCACGACGGGGTGGTATTCAGACTAT
TCACGATTCAGGCAATGGCATTGATATTACCACGTCATTTGTAAAGGTGCCTGGTGGCGACAACGGTGGAAGCTGGGCTG
TGCGGATCAAGGGCGAGCCACGGGAGGAAAACCCAGATGCCAAGACCACGGTGATCTTCTTCCTTTCCCAAGAAGGGGAG
GGGGCTTATCTCGAGCCGGTGGTACCTCTAGAGGAAGACACAGCCATGGGTTTTAGCGGCGATGTCACCCTGAAAGGAAA
AGCAGACCGGCTGGGCGACTTCAAGCTGGTGGTGACTAAAGGCAAAGGCGAGCATCCGAAGAGCGACCATGTGTTCTCGG
AAGAGCGTGACCTTGAAAAGACCACGGTGCAGTCATTGACGGTGTCAGAAGAGCACATGTGGCAGGCCAAGGCCGTGGTG
ATGCAGCAGATCAAGATGAGCGTCGACAAGGTGATCGAAAAGTTCGATCCCACCGACCCGCCGCCGCCGTGGCAGGTCTA
CCAGATGCAGAACCTGCCCGGCCAGGGCAACGTGCACCTGGTGCAGAAGATTTTTGACGGCTCCTTTGAATTCGATCTCC
TCTTCTCGAGCGGATCTGCTGGCAAGGAGCTTACGAGCGACGATGTGACCCGAGAGATCCAAATGACGAGCGAGGCGTTC
AATGAGCGATTCTCGTCGTCCTTTGAACTCCAGCAGCCCTTCACGGCGGATAAGTACAAGAAGTTCGCCCGGAGCATGTT
CTCGAACCTGATCGGCGGCATCGGCTACTTCTATGGCCACGCAGTTGCCGACCGCTCGTACGCCCCTGAGTACGAAGAGG
AGAACGAAGGCTTCTGGGAGGAGGCAGCCGAGGCGCGTGCTCGTCACCGACAGAGCCTGGACGGACCGTACGAGCTGTTC
ACGAGCGTGCCATCGCGGCCATTTTTCCCGCGCGGATTTCTGTGGGACGAGGGATTCCACTTGCTCCCCATTGCCGACTG
GGACATGGACCTGACGCTGGAGGTTGTCAAGAGCTGGTTCAACCTCATGGACGAGGATGGCTGGATCGCACGCGAGCAAA
TTTTGGGGGCCGAGGCCCGCAGCAAGGTCCCGACCGAATTCCAGGTACAGTATCCGCATTACGCCAACCCACCGACGCTC
TTTTTCATCGTCAACACCTTTGTCGAGCAGCTGCGCAAGGTGGCCAATGGCAGCGTGGTTCCACCGGCAGAAAAAGGCGA
GCGCCTGTCGCAAGACTCGGCCTTCCTGGCCAGCGCACATCTCGAGAATCCCGAGGTTGGACTGGAGTACCTGCGCAACC
TGTACCCGCGTCTGAGGCGGCAGTTTGACTGGTTCCGGCGGACGCAGTTTGGCGACATCCGGTCGTACGACCGCGAGGCT
TTCTCATCGCGCGAGGCTTACCGGTGGCGCGGCCGAACTGAGGCCCACGTGCTGACGAGCGGCCTGGACGATTACCCGCG
GCCGCAGCCGCCGCACCCGGGCGAGCTGCACGTCGATCTGATGGCGTGGATGGGCATGATGACGCAGTCGCTAGTCAACG
TGGCCGACCTGCTAGGCCTGGCCGAGGAGGTCAGCTCGCTCAAGACGATCCGCGAGGCCATTGCGCACAATGTGGACGAC
CTGCACTGGTCTGAGGAGGAAGGCTGCTATTGCGACGCGACGATCGACGACTTTGAGGAAAACAAGCTGGTGTGCCACCG
CGGCTACATCTCGCTGTTCCCCCTGCTGGTCGGCCTGTTGGAACCTAGCAACCCAAAGGTGGGCCGGCTGCTGACGCTGC
TGGGCGACAAGGATGAGCTGTTTAGCCCACATGGAATCCGCAGCTTGAGCAAGAAGGATCCGCTGTACGGGACCGCCGAG
AACTACTGGCGCAGCCCGGTTTGGATGAACATCAACTACATGGCCGTTGTGCGACTGCATGTATGTCCCTCATTAGCCCC
CCCCCCCCATCCACAGCACAGAAGAGAGAGCTGACCAGGAACCCCATTAGGATTTGGCGACTCAGCAGGGCCCGTTCCGG
GCGCAGGCACTCGACCTCTACAGCCGGCTGCGACGGAACCTGGTGGACACTGTCTACAAGAGCTGGGAAGAGACCGGCTT
CGCGTGGGAGCAGTACAATCCCGAGACGGGCAAGGGCCAGCGCACGCAGCACTTTACCGGCTGGACGAGTCTTGTTGTGA
AGATCATGACCATGCCAGATCTGAGTGGCAATGGCGGCCATGCCAAGGATGAATTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62