GenePrediction:GLEAN_3188 Details

Name: GLEAN_3188
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:815233..817956 (+ strand)
Length: 2724
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:815233..815319 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_161:815383..816811 (+ strand)
Length: 1429
Type: CDS
Source: GLEAN
Position: GCSC_161:816869..817450 (+ strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_161:817511..817956 (+ strand)
Length: 446
>GLEAN_3188 class=GenePrediction position=GCSC_161:815233..817956 (+ strand)
ATGAGCGACGATGAGGAGGGAGGCTACAACACTGTCACCCAATCCGAGACAGGCCGGGGTGTGAAGCTTCTTTTCTCAAA
GAGCAAGGTATGTTTCCGACTTCTTCCTGCCGTCGCATCCGTGCAGGATCGGTCTCTAATTGCAGCTCAGGTCTACATCC
ACCCTACCCCTTCCACCAAAGACAACATTGCAGGATATATCGCATTGCTGGAACAGAAGTCGCCGCACAACGATGGCCGC
CCAAGCTCGTCCTCGTCTCGAGACTCCAAAACACCGTTGTCCTCGGACCTCCTGCTGGCCTGGGTGCCTGAGTCTTCCCT
CGGCGATGCTGCCAGCGTGTACGTCAAAGTCGACCTCTGCGACGGCGATTCGCCCCCCAAGCAGACCTACCTTGTGCCTC
CACCGCCGACGATCACGACCCACCGGGACTCTGTCGGGTTCTACGCCTTTGCCATACCCGTCAGTGCGGTGTACTCGCTC
CTTGTGCGGCCGCCCAGTATCGGCTGGTGGTTTGGATCGGTTATTATCAACAGCCGGGCCGGCGACAGCTTCCCCGCCCT
TTTTTTCCACGACAATGAGTGCCAATCAACGATTCTCCAGAAACGGAAGCGGACCCGCGAGTCGTTCGACCCGTTCGGCG
AGAATGGAGAGACGTTCTGGGGTGGCGATGAGGTGTTGCGCTGGCTGCGCCGCTACGTGCACATGGAGCGCAGCGGCGCC
GAGCCCAACATATATCTGGTGGAGCCGTCCAAGGAAGACAGCGAAGCGTTTAGTGGAAAGCTGACCAGCTCGCCGTTGGC
AATCGGTCAGCGCGACAGCTTCTCTTCCGGCCGACGACCACGGATGGGCAGGGGGTCTGGTGAAGATGCGGGGCCGTCGT
CACGGCTGCGGACCAGCCACTCGCGCGATGCCGGCATGGATCCGTTCACCAAGTTCGTCAAGGAGGCCGGCTGGAACATT
ATGGAAAAGTTCAGCAAGGTGACCACTTTCACGCGCAACGCGGCCCAAAACGTTTTGGAGGATCCGCGGCTGCCTCCACA
GGTACGGCGGCTGCTGCGCAATCCCGAGGTGCAGACGATGCAGGAGGAGTTTGACAGCGCACGCATATACCTCGCACGCT
GGGCGATGGTCGTGGCCGAGCAGAGCGATCGCGACCGGCACCAGCGGATATGGACGGCCGACGAGGTGATGGAGCTAGAG
GACACAGACGTAGGCGAGTTTGAGCTGGTCGATGGCTCCAGCGGCCTGGCCTTGGAGGAACGACGAAAGCCGGTGACGCT
GAAGGAGTGGAATACGTTCTTCGACCGGCGAACCGGCCGTCTGTCGATCACGACGGACGAGGTGAAGGAGCGCATCTTCC
ACGGTGGACTCGACCCGGAAGACGGGGTGCGCAAAGAGGCATGGCTGTTCCTTCTGGGTGTGCATGAATGGTACAGCACT
GCGGACGAGCGCAAGGCCGAGATTGCGAGCCTACGTGACCAGTACGTCCGGCTCAAGGGCCTCTGGTGGGAGCGGCTTGT
CGACATGGACGGACAAGGCGAAGAGGGCGAGTGGTGGAGAGAGCAGAGAGTCAGGATTGGTAAGTGCTGAGACGACAGAG
GAACGAGGGAAATGCGGAGGCTGACATGTGGATTAGAGAAGGATGTCCACCGGACCGACCGCAATGTACCGATCTTCGCG
GGCGAGAGCATTCCGCATCCAGACCCGGATTCGCCATTCGCCGAGGCCGGGACCAACGTGCATCTGGAACAGCTGAAGGA
CCTGCTCCTGACGTACAACGAATACAACCGCGAGCTGGGATACGTGCAGGGCATGTCGGATCTGCTGGCGCCCATCTATG
CCGTGGTGCAGGACGATGCGATTGCCTTCTGGGCCTTCCAGCACTTTATGGACCGCATGGAGAGGAATTTCTTGCGCGAC
CAGTCGGGAATGCGGGCGCAGCTGTTGGCGCTTGACCACCTGGTGCAGTTCATGGACCCCAAGCTGTATGAACATCTGAA
GGCGGCCGACAGCACCAACTTTTTCTTTTTCTTCCGCATGCTGCTGGTGTGGTACAAGCGCGAGTTCGAGTGGCCGAACG
TGCTGCGGTTGTGGGAGACGCTATGGACCGACTATCTCAGCAGTAGCTTTCATCTCTTTGTCGCGCTGGCCATTCTGGAA
CGGCACCGTGACGTGATCATGACGCACCTGCAGCACTTTGACGAGGTTCTCAAATATGGTAAGCGCCAGGCAAATCCCGG
GGTTTAACATGGTACTCAACACTAACCGATCTTGCTAGTCAATGAACTCTCGGGCACCATCGAGCTGGAGCCAACGCTGA
TCCGAGCCGAGATGCTCTTCCAGCGATTCCGGCGGCTGGTGGAAGCGGTGGACAAGAAGGGCAACTTCCCTGCCCCTCGC
TTGAAGCCATCTGAGCCTTCGACATCGAATCCGGCCTCTAGCTCAGCGGCCCCAGCCGCAAAAGTTCCGGTACAGGCTGC
AGAATACACGGGCGAGTCAGGAACAGAAATGTCCTCGTTTGCAACACGGCCAACTCCTGTCGACGTATTGCCACCACGAG
ACACGGGCAAGGCGCTGGAGACGCCCAGCACAATACCGGAAGCAGTCGAGAACCCGACGCGTGTTATCACTCCGGATTTG
AGGGCTCTGCTCAGCCGGGCAATCTACGTGGTTCCTCACGCGCCAAAGGGCCAGGAAACACTGTGGGGAAACACGAAGAA
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62