GenePrediction:GLEAN_318 Details

Name: GLEAN_318
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1014287..1016431 (+ strand)
Length: 2145
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1014287..1014321 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_167:1014387..1014419 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_167:1014491..1014532 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_167:1014589..1014888 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_167:1014945..1015172 (+ strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_167:1015234..1015270 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:1015340..1016431 (+ strand)
Length: 1092
>GLEAN_318 class=GenePrediction position=GCSC_167:1014287..1016431 (+ strand)
ATGGCTGGCCCCGGCGGTGGACCCCCTCGTCGCAGGTAAGAGACAGGCTCCCATCAAATTTTGTACCGTCCACGGAGTTA
ATGGCTAACATCTCTCTCAGTCACACCAAGTCCCGCAAGGGATGTGAGACTTGGTATGTTTGCCACATGGCGCCTTTTGG
GGCAGCATATACAGGTTAATGGATTTGGCTAACTCTGTCGGCAGCAAACGGCGTCACATCAGATGCGATGAGACCTTTCC
TCAATGGTATGTTATACAGCGGTTGAGGTCCCACGGTCCTCATAATGCTAACTTTTACTTAGCCGCAACTGTACCAAGCA
TAAGATTCGCTGCCCTTACAATGATATCGCCATTCCTGACGACCGCTCCGTTTCGCCTGATCGTCCGGATCTTATGTGGA
CCCCTGAAATTGAGGCTCAAATCAGCCATTGGCAGCAAACCGGCGTCTTCCCCTTTCCGGAACTGAATGTTTACCCGGAA
CCGAATCCTCGATGCTTTTCTGTGGACAATCTGCGCCTGATTTATCATGTTGCTTCGATCTGCCATCAGCTGCGGAGCAT
TGATGCTGACGGCTTCACCATCTGGACGCGCCAGATTCCGACGTGAGTTTTGATTTTTGACCAATTTTGCATTTTTGGCA
TACTGACGATCGTATTAGGATCATCAAGATCGGTGCGACTAACAACTATGTCATGCACGCGCTTCTTGCATTCTCGGCCA
GTCATATGACCTATCTGAACGAATGCCCCGTTGTTGGCATCATGGCAGATGAGCACCGGGGAATTGCCCTCAAGGGGTTG
CAGGAGGCCATCAGCACGTTTTCCAGGGAGACATCGGATGCTATTCTCGCCGCCTCGCTTGTTCTATCTTGGCAGGCTAC
AGACTGGTACGTCGCATAATTGGAAACAGGCAGTGCATCTCACTTACAATCGCTGACCCACTCCCAGGCGTAGCTGGACC
CAGCTGATGCAGGGCACCCGCTCGGTAGGTGACATTTCGGAGCAGTGCTGGCCGTAAGTTGGCTGCGAACTAGACTAACC
CCATCGTTTATAGGTTATCGAAGCCATGGGCCCTTGGAAACATGAATCCCAGTTCGGCGACTTCATTGCCGAAAGCAGCA
CTTTCCCTACGGCTCCGCCGTCTCCTGTTCCGGACCACAAGCCGAACCAGCCTCGCAAGGAGGATCTGGAGTTCTTCGTG
CGCACCACGCAACAGCTGCAGAACGTGGAGGCCTACCTCAAGCACAACAAGGAGGACACCAGGGCCATCTCGCAGCTCAT
TACATTCATTAAGGGCGCTCGGAAGGAAAGCAACACTCCTGTTGCTCAGCAGTTTGCCCGACTTCGCCCTCTGCGTGACT
GGCTTTTCTGGACCCCTGTTCGCTACTTCCAGAGTGCAGGCAGCTCGCCCGGTGCCCTCATCACCATCGCACATCTTTAC
ACGGTGGCTCTGGTCATGGAACGCCTGTTCCCCGAGATCGGTGCGGCGTACTTTGGCAGTCTCTCTATTGGGCCTGTCGA
GGAGATCGCCCGCCGCCTGCTATCGATCAACGTCAATGGCGCCGTGGAAGGCGATGTGCAGACGCCTTTGTCGCTTATGG
AATTCCCCATCGATGTTGTGCACGAATTCCGCTCCCGCATGGGCTGGGTTCACCCGGCTCGCACGCCTTCGTTCCCGCAG
TTCAACCCGCCCAACTTTAGCCACCATGTCTCATCCGTCTCGGGCTCGCTCTCTATGCCGCCCACTACGGGACCGTCAGA
TTATCATCACATGGCTTATGGCGCGGGAGGGATCATGACACACCCGAACTTCAGCTACAGCACGGAAGACCTGTCGCTGC
TGAGTGCTGAACCAAGCCAGAGCTCGGCCATCAGCCCGCTCCAGCTGTCATCCCCATATGTGGCCCAGCAGTACCTCAAC
ATCCCCAGTCCTTCTTATGGAGGCTACAGCCCGGCCTCAAGCACGCTTGGGGACTTCGGCGATGGCTCTTCGGTGGCCTA
CAGCGATAACGATGACTTCGGCCCCTACGACGTGACCTACGCTTCCGGCGGTAGTGTCAACAGCATGGGACATGCCCAGA
TGCTGGGTGGATCAAACAACTTTGGCGTCGGGTTCGTCTCTCCACTCCAGACCGTCTGGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62