GenePrediction:GLEAN_3190 Details

Name: GLEAN_3190
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:822276..823003 (+ strand)
Length: 728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:822276..822313 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_161:822508..823003 (+ strand)
Length: 496
>GLEAN_3190 class=GenePrediction position=GCSC_161:822276..823003 (+ strand)
ATGCTGCGTAAGCACAGGCACGGCGAAGACCGAGAGAGGTGAGCCAGGCCGGCCAGAGGAGGCAAACGAATCAGAAGAGA
TCATAACCGACTAGAAGCTCAGCCCTCGAGACCGGGCATCGCCGGACATCACTAACGTCATCAGCACTGCCTAGGACGGG
GCAGATGCCTCACGATCCCCCCGTTCCGAGAGGGAGTCATAGTACGGCCGCGATGTAACCGACAGATGACAGGACGGACA
GTCTTGGCCGGCAGGCATCGGCCGGCCTGGGTGGAATACGAGGAGGTGCCCGTACAAAGCCAAGGGCGAGGCTGTTTGGG
GTGAGGGGTGAGGGGTTCCTGGATCCGTCGCTGCAGCATGTTCTGAGAGGCGGAGAGCAAATGGAAAAAGCACCCCGGTC
TTCTGGAAGCAATGACACGTCCCAATTCAGTGGTGTCCGAAAACAGAAGCTGCGACGGTCCAGGCTGACGGCTAACGTAA
GCAGAGATGGCCAGTCGGCCGTCAGATTGCAGCATAAGCACGTCGGCAATATTCGCATTATTCATCCACTTGCCTCTGAG
GTCAGCAAATACGAATCGAGGCGCCACCGCAGCGAGGCGCTGCGAGCGTGCGCCCAGTCAGCCCTGCGAGACCGTCTCCC
TTCTTCGTCTCATCCATCAAGCCCAGCGCGTCCGTCTGATCGGTCTCACGCCTGGCGATCCGGCGACAAGACACTGCAGC
CCCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62