GenePrediction:GLEAN_3191 Details

Name: GLEAN_3191
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:832911..833484 (+ strand)
Length: 574
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:832911..833160 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_161:833231..833484 (+ strand)
Length: 254
>GLEAN_3191 class=GenePrediction position=GCSC_161:832911..833484 (+ strand)
ATGGCCCAGTCGACCGCCCACCGCCGCCTGCTGCAGGAATACCGGACGCTGACGAACAACCCGCCCGAGGGGATCACGGC
CGGGCCGGTGTCCGAGGACGACATGCTGCACTGGGAGGCGCTGATTCAGGGCCCCGAGGGCACGCCCTTTGAGGGCGGCG
TCTTTCCTGCCGAGCTGCGCTTCCCCAAGGACTATCCGCTGGCGCCGCCGACCATGCGCTTTGTCGGCTGCGAAGTGTGG
CACCCCAACGGTGAGGCCGGCTGCATTTCTCGTGATCGCATTCCTGACTTGTTCCTGCTGGCTGACCCTCCCTCTTCTAG
TCTACCCCAGCGGCCTCGTCTGCATCTCCATCCTCCACCCCCCCGGCGACGACCCCAACCACTACGAGCACGCGTCCGAG
CGCTGGTCCCCCATCCAGAGCGTCGAGAAGATCCTCATTTCCGTTATGAGCATGTTGGCCGAGCCCAACGACGAAAGCCC
CGCCAACGTCGAGGCCGCCAAGATGTGGCGTGAGCGCCGCACCGAGTACGACAACAAGGTGCGCGTCGGCGTGCGCCGCA
TGTTGGGGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62