GenePrediction:GLEAN_3193 Details

Name: GLEAN_3193
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:841684..843446 (+ strand)
Length: 1763
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:841684..841973 (+ strand)
Length: 290
Type: CDS
Source: GLEAN
Position: GCSC_161:842048..843446 (+ strand)
Length: 1399
>GLEAN_3193 class=GenePrediction position=GCSC_161:841684..843446 (+ strand)
ATGGCTGCCTTTCTCAGCCGCCTGAACCCAGTGCCATCCTTCTCCAACTTCACCGGCCCGTACAGAGTAGGCACCATCGA
TGTCGAGATCCCGGTGACAGCCTTGGATTCGCCGAGCCCAACGCCCGACCATGCAGACGGCATACACACGGTCCAGTTCC
GCATATTCTACCCGATTGCCCCAGATGCCGAGGGCAGATACATCAGCTGGCTGCCGGCGCCGCAGCGCAGCCACGTCTCG
GCGTACACGCAGTTCCTGGGTGCTGGTCCCATCTTGGCCGAGTTCGTCTCGTGAGTGTCTCTGCAGGCCTGGTGTCTCGT
GTGACTTGGACGAGTGTCTACTGACCAGTGCCCATCTCCGACAGCTTCCTCCCTCGACACCTTTACTACACGACGATCCC
GGCGCGCAAAAACGCAGCGCTACTGGAGCCCACGACGCCCAGCCGACGGTGGCCGACGATGATCTTCTCGCACGGGCTGG
GCGGCAGCCGCAACGCATACTCGCACATGGCCGGCTCGGTGGCTTCTCACGGCGTCGTAGTAGTCTGTCCAGAGCATCGT
GACGGCAGCTCGGTGGTCTCGTTTGTGCGCGACCCGGCGGCCCAGGACCGCTTCTTCCGGCGAAGCACGCGCACCGTCAT
TCCCTACCTCCACAAATCGCACGCGGAGACGGACGAGGAGTGGGCTCTGCGCGACCAGCAGCTGCGCATCCGGCTGTGGG
AACTGGGCCTCGTGCACGACGCCCTCGTGCGGCTGGACGAGGCCAGGCCGCTGGTGAACCTGAACGGCAGCACGCCGGCG
ACATCGCTGGCCCAGTTTGCCGGCAAGCTGGCCGTACACAGCCCGGGCGACATCATCTGGGCCGGCCACAGCTTCGGCTC
GGCGTCGGTCGTGCAGCTGCTCAAGACGACGTACTATGCTGACACGGACGGGATGGCGTCGATCAAGAGCCCGCTCTTCA
CGCCGCGGCCGGACTCGCGGTTGCGCGCCCAGATCAGCGAGACGAGTCCGACCATCTTGCTGGACCTGTGGTGCTTCCCG
CTGCTGTCGCCCGAGCAGCACATGCTCTTTCAGCTGCCGCTGCCGGCGTACGCAGACGTGCCTGACGCGGCCGGCGGCCG
GGCCATTCTGGCCGTCGGTTCCGAGACATTTTACAAATGGACGCCGCACCTGCACACGACGGCGCGGGTGTTGTCGCCTG
ATCCATCGGCAGCCGTGGTGTCATCGGCGGCTTACCTGCGGCCCAACGGCATACGACTGTCGGAACCCAACTACTTTTAC
GTGCGGAACAGCGCGCACCTGAACCAGAGCGACTTTGGCCTGCTGTTTCCGTGGCTGACGGGCAAGATCTTTGGCGCCAC
CAAGCCCGAGCGCGCCCTGCGCCTAAATCTGCGCGCCATTCTGCAGATGCTGCGCGCCAACGGACGGTCTGTGGCTCGCA
CGTGGGCCGGCGACCTGGTGGACGGTTCCGACGTCGACAAGCTGGGCGCGGCCACAGCTGCTGGCCCAAGCGACGGCATC
GACGACGACAAGGCCATCTTTGACCACGGCAGCGGTATCGAGAGCTGGGCCTGGATCGACATTATCGGTCTCGGTACCGA
GGCCCCCGACAGTGGCAGTACACTCTCACGGACGCCAGAGCACGACGGCGTCAGCACGGAAACTGCAGTGGCGGACAACA
AGGGCAAGCAGGCCGTCGACAAGGAAATGGAGCCGCATCTGGCCGTAGCATCTAAATCTGGCAACGCAGTGACAGCGCCA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62