GenePrediction:GLEAN_3194 Details

Name: GLEAN_3194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:843689..845649 (+ strand)
Length: 1961
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:843689..843709 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_161:844003..844113 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_161:844184..844241 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_161:844310..845243 (+ strand)
Length: 934
Type: CDS
Source: GLEAN
Position: GCSC_161:845295..845649 (+ strand)
Length: 355
>GLEAN_3194 class=GenePrediction position=GCSC_161:843689..845649 (+ strand)
ATGAGCCAAGATGAAGTCATAGTCCCCGGTAGCTCCTGCCGATTCGTCGAGCTGGCTTTACGCTTTTTACGCTTATTTAT
GTTCCCCACCGGCTGAGCGTCTCTGAGCGGCCTCTGCAAGTTCTGTATTCGGCATCCAACTTCACTGTCGACTAAAGCCT
TCAGTCTGCAGTCGCCCATCTTCGCATCAACAATCGGTTGCCCATCATGTCCAACGGCGGCCCTCCACATGGCGCGGCCG
ATGATTATTACAGCAATTCGCAATACCAACAAAACCTACAACAGCAGCAACAGCAACAACAGCAAAACCCACAGACTTAC
GGCGCGTATGCACCTCCACAGTTTGGCGGAAACGAGAAGAAAGACTTTGACCAGGTGTTTGTCCTGCAAGGACCCAAGTA
TCACGACATCTGGGCGGGACTGCTGGTGAGAATGGCCGGCGACCAGTCTGACATCTCTCGGCGTTGGTAAATGAAACTGA
CGAAGCGGAATGCAGTTCTTGGCCTGTGTCGCCGGGTTCACTGCCGTCTCCGGCATCACCATCCACGCATACGGTGCGCT
TCCGTCGGGCCCTGGTCTTCTCCCCCTCGTACGTCTCCGCTAACACGGCTTCGGCTGGCAGCAACGACCAAGTCGAGCAG
CGGCAACGGCATTTACGATGGCGACACCACGTTTGGGCTCAACACCAACTCGCTCATCTGTCTGCTGATCTGTGTCGGCA
TTGCGGTCGTGCTCAGCGTGCTCTACATGTGGGCAGCCCGCGTGCTGACTAAGGCGCTGATCTGGATCACAGGCATCCTC
AACATCTGTCTCGGCCTCGCAACCGCCATCTACATGCTGTATCGCCACTATTACTCGGGCGGCATCGTCTTCCTCGTCTT
TGTGGCACTCAACATCTTCTGCTTCATCTCGTGGATCCCACGCATCCCCTGGAGCGTGCTGATGCTGCAGACCACCATCG
ACGTCTCGCGCCGTTACGGCCACGTCTACATGGCCAGCCTGCTCGGTGGCCTCTCGGCAGCCGCCTTTGGCGTCTGGTAC
TCGGTCACCATGGTGGCCGTGTACGTCAAGTACGAGCCGGGCAGCGGAAATGCGGCCTGCAGCACGACCGGTGGCAGCTG
CAGCAAGGCCAAGGTCATCGGCATCATGGTCTTCATCACCTTTGCCGGCTACTGGATCACCGAGTGGCTCAAGAACACGA
TCCACACCACCATCGCCGGCGTCTATGGCTCCTGGTACTTTGCCGGTGACAACGCAAATCACTACCCGCGCGGCACTACG
CGCAGCTCTCTCCGTCGCGCCACGACGTACAGCTTTGGCAGCATCAGCCTCGGCAGCTTGGTCGTCGCCATTATCAATTT
TCTGCGCCACCTCTGCTCCATTGCGCAGCAGCAGTCGGCCAACGACGGCAACATCATGTCGACCATCTTCTTCTGCCTCC
TCGGCTGCTTCATCTCCATCCTCGACTGGGCCGTGCAGTTTGTCAACCGATATGCCTTTTGCCACATTGCCCTCTATGGC
TCGTCGTACTTCCGCGCGGCCAAGGATACGTGGACGTGAGTAGACTCTCCCCCTCGACCGTTATATCAGTGAACTGACCC
GCCTAGGATGATCAAGAACCGCGGTGTCGACGCTCTGGTGACGCAGTGTCTCATCGGGCCGGTATTCAGCATGGGAGCGG
TATTTGTGGCTTACGCCACAGCTCTGTCGGCATACGTGTTTCTACGCATCACCGACCCTGCATACAACCAGAATGGCGAC
TACACGCCGGTGCTGGTGGCATTTGCTTTCCTCATCGGACTGCAGATCTGCAACGTGTTCACGGTGCCGATCAGCAGCGG
CATCGACACCATCTTTGTGGCCATGGCGTGGGATCCGCAGGTGCTGACCCAGCGTCACCCCGAGCTTTACGGACGCATGG
TGCAGGTGTACCCGCAAGTGCAGCAGGCGGTGCATGGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62