GenePrediction:GLEAN_3198 Details

Name: GLEAN_3198
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:870670..872048 (+ strand)
Length: 1379
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:870670..871467 (+ strand)
Length: 798
Type: CDS
Source: GLEAN
Position: GCSC_161:871536..872048 (+ strand)
Length: 513
>GLEAN_3198 class=GenePrediction position=GCSC_161:870670..872048 (+ strand)
ATGTCGTATATCACAGACGGGCAGAACGGCCTGGAGGCGGTTGAAGGCAAGAAGTGGAAAGAGGGCATCGAGCTTCTTTC
CAAGGCGCTGGAGCATTCAGAGAACCCAGCCTGGCTGCTAGCTCGCTCGCATGCGTACCAGGAGACCAAGGAGCTCGCGC
TCGCCCTGGAGGACGCCGACCATGCGTACGTCAGTGCGACGGAGCGGCAGCATGCCAAGAGCCGCGAGCAGATGGCCCTG
GCCCAGTACCGACGGGCAGTGATCCTGGGCCATCTGAAGCGTTATGCGGATGCCGATGCCTGCTGCGTGTGGTCGCAGCA
GCTGATGGAGGGCAAGAATTTCCGGCGGGAGGAGGATGATGTGGCGAAGCACGTGGACGAAGAGGGAGACTACCTGGCGA
CGGCCGAAGAGGCCCTGTCGACGTCGACGATGCCGGTGGACAAGCAATCGGAGCGTGGCGCTGTTCCGGATCGGCGCACG
GGTGCTGTGGAGTGGTCGCGTGCGTATGTGTGGCGGTCGATGATGCTGAACGCGATGGCAAAGCTGCCTAAGGGCGATGC
GGGGCGCAAGATCACGGTGGCTCGCGTGCCGATGAAGCCGGCCAAGAAGGCTGCGGCTGTCGATATGCACGAGGTGAAGT
CGGATATGACGCCGACAAAGACTGCGGAGACGAAGAAGGAATGGGCGACTAAGAAGCTTCGTGTGGACTTTTACCAGAAA
CCCGAAACGGTCAACCTGGTGCTCTATGCCAAGGGCGCGGACAAGGACAAGGTGCAGGTTGATGTGCGGGAGCTTGAGGT
TTGTGGCGTTCCGAATCCGGGTGGCAAAATGTATCTGCCGTGTTGCTTACGTGTGTTGTGATGCAGATCGTTCTCTCGAA
CCTGCCGGAGGCAGCCATCGGCAGCACATGGGCGGTTCTCGATCTCAGCGGCGAGGTCGATCCAGCCGACAAGACGATCC
GGGTGACGCCGTTCAAGATCGAGCTCACGCTGAAGAAGAAGCTTGTGGGGACGAAGTGGGCGACCTGGGGCACACAGAGG
GAGGAGGGCAGCGGTGTCCGGCCAACGTTTAGCGAGTGCAGCACGGCCAGCAGCACGCAGGCGACCAGGAGTGCTGGGCC
GCTCTTGTATCCGTCCAGCTCGCGGACGGGGCCGAAGAACTGGGCGACGGTGGACCTGGGGGACGAGGATGAAGAGCAGA
ACGACGTCAACGCGTTTTTCAAGAAGCTGTATGCGGGCAGCACGCCGGAACAGCAGCGGGCGATGGCCAAGAGCTTTACG
GAGAGCAACGGGACATCTCTGAGCACGGACTGGAGCTCGGTCAGCTCGGGCCCGGTGGCGACGCAGCCGCCGGACGGGGT
GGAGGCGAAGAAATGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62