GenePrediction:GLEAN_319 Details

Name: GLEAN_319
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1025790..1027170 (+ strand)
Length: 1381
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1025790..1025871 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_167:1025926..1026540 (+ strand)
Length: 615
Type: CDS
Source: GLEAN
Position: GCSC_167:1026799..1027005 (+ strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_167:1027073..1027170 (+ strand)
Length: 98
>GLEAN_319 class=GenePrediction position=GCSC_167:1025790..1027170 (+ strand)
ATGGATGAATACGAATATGATTATCTCGAGACAGGTCAGGAGCACTTGGGTGATAGCACCTCTATCGCAGGCGTCAAAAC
AGGTGAGAATGTTGTGTCAAATTGGAACGCTGAAGAGGCTCTCACACATTGCGTAGAGCAAGACAATCTGCCTGCTGTAG
ATGCCGTGCACAACTACAATAAGCCTCGCACATCTATCCCGAATGAAGTAGATGATGTAAGTAACCGGCTCGGTAGAGTG
TCGCTATCATCAAATGATTCCATCGATGATTTCAACTACGATTATACCTCCAGCATGCCCTCGAGTATCACCACGGGGAC
GCAGGCCACAGCCTTGTCCTTAACCAGCGCACGATACACACATCGACCATACAAGGGTAGCCACATCCAACGAGAACCCC
CGGTTCAGACTCCAGAGTTGCGGGACACATCCTCGTCCGGAAACCAGTCTCAGTATACGGCCTACACACCAAGCACCAAT
TACACCCAGATGCACCAGTACGGGTACCCAGGCTTAGGGAACAATTATACTCAGCAGCCCCAGTATGTGCATCAAGAACT
TGGAGCCGACTATGTCCGAGAGCCTCAGTATGGGTACCAAGATACCGGCTCCGGTTATATCCAACAGTCTCCGTATACGT
TCGCAGCAACTGGAGCATTTTTTAGCCAGAACGTATACAGTGTACAAACCAAAGGAATGGAAAACGATACCCCCCATATA
TCCAACCACGAGAGATCCGGATCGTATACTAGTCCCCATGTCCAGAGTGCAGACCCAGTGCAGTCTCCTGTGGACTCGAG
TTATTCGCAGACCCCACACCCCAAGCACAGTTCCAGAAATCCAGCTCCTTTAATGAAAATCAGCTCTACGCCTAGGAGGG
GATCAAATACATCCACAAGGTCGAGGGGACAGAATCACACGATTCCCACGCTCGAAAGAGGCAACAGCCGGTGTCAGTTT
TCTCGTATGAATATATCTTCAAAACCCTAACCCGGCTGACATTATCAAGATTCGGGTGATGTTTACCCACAGCCAGGTCT
GAGTGCTTACACTTCCAGCTATTACGAACACTCAAAGCAACAGTCCATCACCGTCGGTGTTGTCAATCCTTATGATGAAA
ACCAGCAACGGCCATTTGCATCTGGGCCAGTGCCGTCATCGTCCACATGGGATCCAGGCTACGTCGCGGATTTCGACTCG
AACGAGAAACTGCAAGGTGAGACTAGCTATATTGTTATATGATATGAATAGACCGATGGCTACCTGGGCTGACATGTATA
TAGGGCTTAAATACCCTATTGAAGATGGAGATGACGAGCTGTTGGGCGATCTAGCCGACCAGCAGATGACATCAGGCAAT
AATATGCCAGGCAAGATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62