GenePrediction:GLEAN_31 Details

Name: GLEAN_31
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:222088..225108 (+ strand)
Length: 3021
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:222088..223465 (+ strand)
Length: 1378
Type: CDS
Source: GLEAN
Position: GCSC_179:223661..224861 (+ strand)
Length: 1201
Type: CDS
Source: GLEAN
Position: GCSC_179:225096..225108 (+ strand)
Length: 13
>GLEAN_31 class=GenePrediction position=GCSC_179:222088..225108 (+ strand)
ATGGCAGGGTCGCAGCTGAAGCGGCTCAAGTCGTCGCTGCGCGAGCAGGGCATCATCGGGCCGCAAAAGTCGAAGAAGCA
GAAGAAGCAGGCAGCCGAGGAAGCGCGGGCGAATGGCGGCAGCGAGAAGCGACTGCGCAAGACGGCAGCGCTGGAGACGA
TCCGGGAGCAGTTCAACCCATTCCAGTTTAAGATGAACGCGCGGGGACCCAAGTTTCCGGTCACAAGCCTGCGGACGCAG
AAGGAGGGCCTGCGGGGGATCAAGGGACGGCCGCAGGTGGCGCTATCCCGGAGCGAGGAGAAGCGGCGGAGCACGCTGCT
CGTCGACATGCAGCGGCGCAACAAGGTGGGCGGGATCCTGGACCGGCGGCTGGGCGAGGGCGACCCGAACATGACGCCGG
AGGAGCGAGCGCTGGAGCGGTTCGCGTTTGAGAAGCAGCGCACCCACAGCAAGAAGGGGGCCGTATTCGACCTGGAGGAC
GACGGCGACGACGACGTCGGGCTGACGCACATGGGCCGGTCGTTGGCGGTCGGCGACGACGGCGAGGCGGCTGAGTCGGA
CGAGGGTCTGCGGCTGGTCGACCATCTGCGGGATGACTTTGACGAGGACCTGTCGGACGGCGAGTCGGACGACGACAGCG
AGCAAGACGTCAGGCTCAAGCAGCTCAAGCGGATGCGCAGCGAGGCAGCCCTGGCCGAGTCGGGCGGCGGGACGGACGAG
CCCGAGCGCAAGAAGACAAAGAAGGAGGTGATGCAGGAGGTGATTGCCAAGTCGAAGCTGCACAAGTACGAGCGGCAGGT
GACGCGCGAGGCCGACGACGACGAGCGGGCGGCCCTCGACAAGATGCTGCCGGAGCTGCAGTCGCTGCTGCTGGCACCAC
GCGCGGCGACGACGACGACGGTCGGGGACAAGACCATGAAGCTGGCGGGTGGACTGCTAGCCGACAAGGTCGACAAGGCG
GCACTTGAGAAATCGTACGACGTGCGGTTGCGCGAGCTGATGCAAGACAAGAAGGCAGAGCCGTCGACGCGGACGAAGAC
GGAGGAGGAGGTAGCAGCCGAGCAGTCGGCCCACCTGAAGAAGCTGGAGGAGAGCCGGGTCAAGCGGATGCTGGGGCAGG
TGGAGTTTGAGGAGGGCGGCGAGGGTGAAGAGGGTGAAGAGGGAGGTGGCAAGACGGACAAAAAGGACAAGCAGGCCAAG
GACGACCGGCCCTTCTCGTTTCCCGGCCAGGACGACGAGGACGAGTTTGCGTTGGGCCAGGGCATCCGGGTACGCCACAC
GGCAGCCGAGTTGGGGTTTGACGACGAGGACGACTTTCTGATCGACGACGATCTCGTGGCCAGCGGCTCAGACGTCGAGG
AGGCCGACGACAGCGAGAGTGAGGAGGAGAGCGGCGGCGAGGAGGAGGAGGAGGAGGATGACGAGGACGACGAGTTCACG
CGTGGCCTGCTTACTGAAGAAGAAGAAAAGGACCCGGCTTTTTCGCGGGCAGCAACAACAACAACAACAGCAACGGACGA
CGACGGCATCCCGTACACGTTTCCGTGTCCGCAGACGCACGCCGAGCTGCTAGCGGTGCTGGAGTCGGTGCCGATGACGG
GGCTGGCGACGGCGGTGCAGCGGATCCGGGCGCTGCACCACCCGAAGCTAGAGGCCGGCAACAAGGAGCGGCTGGGCCGG
TTGGCGGCGGCGCTGGTGGTGCACGTGGTGTATCTGGGCGACCAGCCGAGTCCATCCCACCACGTGATTGAGAGCCTAGT
GCGTCACGTGCACTCGCTAGCGAAGATGGTACCGATCGACGTGGCGGTGGCCTTCCGGGGCGAGCTGGCGCGGATGGTGA
GCGCCAACAGGCTGACGCCGGGCGATCTGGTCCTGCTGGCAGCCGTGGCCATGTTCCCGACGTCGGACCACTTCCACCCG
GTGGTGACGCCGGCCGTGCTGGCCATGGGCCGCTTTCTGGCGCAGCGGCCGCCACGGACAGCGGCCGACTGTGGCGCCGG
TCTGTTTGTGTGCACGCTGCTGCTGCAGTTCCAGCAGCGGGCGCGGCGCTACGTGCCCGAGCTGCTGACGTTTGTCTGTG
GTGTGGCCATGGCCCTGGCGCCCGTGCCGCTGTCGCCGGCTGTGCGTCGCCGGCTGCACGGCCAGATTCCGCTGCACGCG
TCGGCAGAAGCGTTGCGGGTGGCCACCGACAAGGCGGAGCCGCGGCGGCTGCGGCCAGCCGACTGCCAGCCTGACAGTCT
TCCTTCCGAGGCGCTCAAGAGCTCCCTCCTGGCCACCGCCGTGGCCGTCCTCGAGGCTGCCACGGCTCTCTGGGCCGACA
AGGCTGCCGTGGCCGAGTCGCTCGCTCCGGCCATCGAGATTCTTCGACACCTCGCTGCTAGCCCGGTCGGCTCCCTTCCC
GCTTCTGTCCGACAGGCTGTCACGCGCGCGCTTACCACCGCCGAGGCTGTCGGTGCTGCCGCACAGCTCGCTCGCCGGCC
GCTCGAGCTTCACCACCATCGGCCGCTGGCTATCCGCACGCTCGTCCCCCGGTTCGAGGACGAGTTCGACCCCGACAAAC
ACTACGACCCCAACCGCGAACGGGCCGAGGCCGCCAAGCTGCAGGCTGAGCTCAAGCGCGAGCGCAAGGGCGCGCTGCGC
GAGCTGCGCAAGGACGCCGCCTTCATGGCGCGCGAGCAGCTCAAGCTCAAGAAGACACGCGACGCCGCGTACGAGAAGAA
ATACAAGCGGCTGGTCGCCGAGATCCAGGGACAGGAGGGACACGCGGCCAATGAGTACGAGCGCGAGCGGCAGAAGCGGA
AGAGGAGGTAGGGGGGAAGAGATGGGAGAGAAAGACGAGAAGGCAAAAAAGTTGGAGGGGAGAAGATCGGAATACAGACG
GCGAAAAGAAGGGAGGAGAGAAGGAGGGCGAGACAGATACAAGAGGACAGCGGAACAGAAGACAGAAGAGCAAGGGAAAG
GAAGTAAAAGGCAACTGGATGGTCTATACAATATATTATTCTTCAAAGTTGGTTGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62